Explore Topics:
AIBiotechnologyRoboticsComputingFutureScienceSpaceEnergyTech
Biotechnology

How Computers Will Crack the Genetic Code and Improve Billions of Lives

Peter H. Diamandis, MD
Jun 22, 2015

Share

Machine learning and data science will do more to improve healthcare than all the biological sciences combined.

This post is about how we're going to gather that health data, mine it and improve the lives of billions.

This post is also a search for the best data scientists and programmers in the world, who want to join Human Longevity Inc. (HLI) and work on the most epic challenge — extending the healthy human lifespan. (See bottom of post for details.)

What's the Big Idea?

Your genome consists of approximately 3.2 billion base pairs (your DNA) that literally code for "you."

Your genes code for what diseases you might get, whether you are good at math or music, how good your memory is, what you look like, what you sound like, how you feel, how long you'll likely live, and more.

This means that if we can decipher this genomic "code," we can predict your biological future and proactively work to anticipate and improve your health.

It's a data problem — and if you are a data scientist or machine-learning expert, it is the most challenging, interesting and important problem you could ever try to tackle.

In the simplest terms, sequencing a genome means turning DNA into a series of four letters that looks like this:

ACAAGATGCCATTGTCCCCCGGCCTCCTGCTG

Each person's genome produces a text file that is about 300 gigabytes.

When we compare your sequenced genome with millions of other people's genomes AND other health data sets (see below), we can use machine learning and data mining techniques to correlate certain traits (eye color, what your face looks like) or diseases (Alzheimer's, Huntington's) to factors in the data and begin to develop diagnostics/therapies around them.

HlI - Biological Data

It's a Translation Problem, Like Google Translate

HLI is creating an "integrated health record" for everyone entering its database. The data sets created will include the following:

  • Genomic: The 3.2 billion nucleotides from your mother, and the 3.2 billion nucleotides from your father.
  • Microbiome: The genome of the 100 trillion + microorganisms living in our bodies. There are 10 times as many microbial cells than human cells, and their effects on our bodies are enormous and massively understudied.
  • Imaging/MRI: High resolution detailed imagery of our brain, organs and body.
  • Metabolome: The 2,300 small molecule chemicals in your bloodstream.
  • Physiological Health Data: All of the data we can collect on ourselves. Our vital signs, blood glucose levels, micro RNAs in the bloodstream, heart rate, VO2…

Translating between all of this data and your health outcome is, metaphorically, similar to how Google Translate works.

Google Translate (GT) uses a process called statistical machine translation, which means that GT generates translations based on patterns found in large amounts of written text.

Rather than attempt to teach the computer every rule of every language, this approach lets the computer discover the rules for themselves based on statistically significant patterns in the data.

Once it finds these patterns (patterns that are unlikely to occur by chance), it can use this "model" to translate similar text in the future.

With millions and millions of documents/websites/publications online that were already translated, and a crowd of 500 million users to correct and "teach" the algorithm, GT can quickly and accurately translate between 90 different languages.

Our challenge now is applying similar techniques to all of this genomic and integrated health records… and we found the perfect person to lead this effort: Franz Och — the man responsible for building Google Translate.

Meet Franz Och, HLI's Chief Data Scientist

Franz is a renowned expert in machine learning and machine translation.

Be Part of the Future

Sign up to receive top stories about groundbreaking technologies and visionary thinkers from SingularityHub.

100% Free. No Spam. Unsubscribe any time.

He spent 10 years at Google as a distinguished research scientist and the chief architect of Google Translate, literally building the system from the ground up.

Now, Franz is Human Longevity Inc.'s chief data scientist, responsible for developing new computational methods to translate between all of the human biological information.

… and he's building one of the most impressive teams I've seen.

When you ask Franz why he's so excited about HLI, his answer is twofold: the mission and the challenge.

Franz explains, "The big thing is the mission — the ability to affect humanity in a positive way. If you are a data scientist, why focus on making a better messaging app or better Internet advertising, when you could be advancing the understanding of disease to make sick people better and of aging to make people live longer, healthier lives?"

As far as the challenge, he goes on: "The big mission is to learn how to interpret the human genome — to be able to predict anything that can be predicted from the source code that runs us."

HLI Is Looking for World-Class Talent

HLI is looking for the following:

  1. Very strong software engineers who can build reliable, high-quality, high-performance software
  2. Machine learning experts
  3. Statistics experts

Many people with these areas of expertise often don’t know about biology and health, and that is okay. We need the outside perspectives to help us tackle this problem in new ways.

At the same time, we are also looking for people with the relevant biology knowledge (genomics, immunology) who are excited to approach their domain in a new way as a massive data and machine-learning problem.

If You Think You Have What It Takes, I Encourage You to Check Out the Open Positions Here and Apply.

The machine learning team is based out of Mountain View, CA; the genomics team is based in La Jolla.

Here is the link again: http://www.humanlongevity.com/careers/open-positions/

If you know of anyone who you believe fits the description above, please share this post with them and help us move humanity forward.

Image Credit: 3dmotus/Shutterstock.com

Diamandis is the founder and executive chairman of the XPRIZE Foundation, which leads the world in designing and operating large-scale incentive competitions. He is also the executive founder and director of Singularity University, a global learning and innovation community using exponential technologies to tackle the world’s biggest challenges and build a better future for all. As an entrepreneur, Diamandis has started over 20 companies in the areas of longevity, space, venture capital, and education. He is also co-founder of BOLD Capital Partners, a venture fund with $250M investing in exponential technologies. Diamandis is a New York Times Bestselling author of two books: Abundance and BOLD. He earned degrees in molecular genetics and aerospace engineering from MIT and holds an MD from Harvard Medical School. Peter’s favorite saying is “the best way to predict the future is to create it yourself.”

Related Articles

HIV viruses emerge from an infected cell

New Immune Treatment May Suppress HIV—No Daily Pills Required

Shelly Fan
A full jar of peanut butter as viewed from the top

Scientists Just Developed a Lasting Vaccine to Prevent Deadly Allergic Reactions

Shelly Fan
One Dose of This Gene Editor Could Defeat a Host of Genetic Diseases Suffered by Millions

One Dose of This Gene Editor Could Defeat a Host of Genetic Diseases Suffered by Millions

Shelly Fan
HIV viruses emerge from an infected cell
Biotechnology

New Immune Treatment May Suppress HIV—No Daily Pills Required

Shelly Fan
A full jar of peanut butter as viewed from the top
Biotechnology

Scientists Just Developed a Lasting Vaccine to Prevent Deadly Allergic Reactions

Shelly Fan
One Dose of This Gene Editor Could Defeat a Host of Genetic Diseases Suffered by Millions
Biotechnology

One Dose of This Gene Editor Could Defeat a Host of Genetic Diseases Suffered by Millions

Shelly Fan

What we’re reading

Be Part of the Future

Sign up to receive top stories about groundbreaking technologies and visionary thinkers from SingularityHub.

100% Free. No Spam. Unsubscribe any time.

SingularityHub chronicles the technological frontier with coverage of the breakthroughs, players, and issues shaping the future.

Follow Us On Social

About

  • About Hub
  • About Singularity

Get in Touch

  • Contact Us
  • Pitch Us
  • Brand Partnerships

Legal

  • Privacy Policy
  • Terms of Use
© 2025 Singularity