How Computers Will Crack the Genetic Code and Improve Billions of Lives
Machine learning and data science will do more to improve healthcare than all the biological sciences combined.
This post is about how we're going to gather that health data, mine it and improve the lives of billions.
This post is also a search for the best data scientists and programmers in the world, who want to join Human Longevity Inc. (HLI) and work on the most epic challenge — extending the healthy human lifespan. (See bottom of post for details.)
What's the Big Idea?
Your genome consists of approximately 3.2 billion base pairs (your DNA) that literally code for "you."
Your genes code for what diseases you might get, whether you are good at math or music, how good your memory is, what you look like, what you sound like, how you feel, how long you'll likely live, and more.
This means that if we can decipher this genomic "code," we can predict your biological future and proactively work to anticipate and improve your health.
It's a data problem — and if you are a data scientist or machine-learning expert, it is the most challenging, interesting and important problem you could ever try to tackle.
In the simplest terms, sequencing a genome means turning DNA into a series of four letters that looks like this:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTG
Each person's genome produces a text file that is about 300 gigabytes.
When we compare your sequenced genome with millions of other people's genomes AND other health data sets (see below), we can use machine learning and data mining techniques to correlate certain traits (eye color, what your face looks like) or diseases (Alzheimer's, Huntington's) to factors in the data and begin to develop diagnostics/therapies around them.

It's a Translation Problem, Like Google Translate
HLI is creating an "integrated health record" for everyone entering its database. The data sets created will include the following:
- Genomic: The 3.2 billion nucleotides from your mother, and the 3.2 billion nucleotides from your father.
- Microbiome: The genome of the 100 trillion + microorganisms living in our bodies. There are 10 times as many microbial cells than human cells, and their effects on our bodies are enormous and massively understudied.
- Imaging/MRI: High resolution detailed imagery of our brain, organs and body.
- Metabolome: The 2,300 small molecule chemicals in your bloodstream.
- Physiological Health Data: All of the data we can collect on ourselves. Our vital signs, blood glucose levels, micro RNAs in the bloodstream, heart rate, VO2…
Translating between all of this data and your health outcome is, metaphorically, similar to how Google Translate works.
Google Translate (GT) uses a process called statistical machine translation, which means that GT generates translations based on patterns found in large amounts of written text.
Rather than attempt to teach the computer every rule of every language, this approach lets the computer discover the rules for themselves based on statistically significant patterns in the data.
Once it finds these patterns (patterns that are unlikely to occur by chance), it can use this "model" to translate similar text in the future.
With millions and millions of documents/websites/publications online that were already translated, and a crowd of 500 million users to correct and "teach" the algorithm, GT can quickly and accurately translate between 90 different languages.
Our challenge now is applying similar techniques to all of this genomic and integrated health records… and we found the perfect person to lead this effort: Franz Och — the man responsible for building Google Translate.
Meet Franz Och, HLI's Chief Data Scientist
Franz is a renowned expert in machine learning and machine translation.
He spent 10 years at Google as a distinguished research scientist and the chief architect of Google Translate, literally building the system from the ground up.
Now, Franz is Human Longevity Inc.'s chief data scientist, responsible for developing new computational methods to translate between all of the human biological information.
… and he's building one of the most impressive teams I've seen.
When you ask Franz why he's so excited about HLI, his answer is twofold: the mission and the challenge.
Franz explains, "The big thing is the mission — the ability to affect humanity in a positive way. If you are a data scientist, why focus on making a better messaging app or better Internet advertising, when you could be advancing the understanding of disease to make sick people better and of aging to make people live longer, healthier lives?"
As far as the challenge, he goes on: "The big mission is to learn how to interpret the human genome — to be able to predict anything that can be predicted from the source code that runs us."
HLI Is Looking for World-Class Talent
HLI is looking for the following:
- Very strong software engineers who can build reliable, high-quality, high-performance software
- Machine learning experts
- Statistics experts
Many people with these areas of expertise often don’t know about biology and health, and that is okay. We need the outside perspectives to help us tackle this problem in new ways.
At the same time, we are also looking for people with the relevant biology knowledge (genomics, immunology) who are excited to approach their domain in a new way as a massive data and machine-learning problem.
If You Think You Have What It Takes, I Encourage You to Check Out the Open Positions Here and Apply.
The machine learning team is based out of Mountain View, CA; the genomics team is based in La Jolla.
Here is the link again: http://www.humanlongevity.com/careers/open-positions/
If you know of anyone who you believe fits the description above, please share this post with them and help us move humanity forward.
Image Credit: 3dmotus/Shutterstock.com
Peter Diamandis
He is the founder and executive chairman of the XPRIZE Foundation which leads the world in designing and operating large-scale incentive competitions.
He is also the co-founder and executive chairman of Singularity University, a graduate-level Silicon Valley institution that counsels the world’s leaders on exponentially growing technologies.
Diamandis is also the co-founder and vice-chairman of Human Longevity Inc. (HLI), a genomics and cell therapy-based company focused on extending the healthy human lifespan.
In the field of commercial space, Diamandis is co-founder and co-chairman of Planetary Resources, a company designing spacecraft to enable the detection and prospecting of asteroids for fuels and precious materials.He is the also co-founder of Space Adventures and Zero Gravity Corporation.
Diamandis is a New York Times bestselling author of two books: Abundance – The Future Is Better Than You Think and BOLD – How to Go Big, Create Wealth and Impact the World.
He earned degrees in Molecular Genetics and Aerospace Engineering from MIT, and holds an M.D. from Harvard Medical School.
His motto is, “The best way to predict the future is to create it yourself.”
Latest posts by Peter Diamandis (see all)
- Massive Disruption Is Coming With Quantum Computing - October 10, 2016
- Designer Babies and the New Technology of Having Children - October 3, 2016
- 5 Tech Forces That Will Change Insurance for Good - September 26, 2016
Discussion — 16 Responses
You must be logged in to post a comment.



Brilliant! I hope this comes to pass, and that indeed it will turn health care from authority based agencies into customer led showrooms of solutions. Something that requires expensive operations on individuals is never going to help more than a lucky few.
If you can scan your own body in some way, send data to a service provider, and get back some sort of tailored product to swallow or otherwise use, then billions of people can benefit, not just those that live near and can afford to use a hub hospital.
As a case study we can see the hepatitis C treatment which came down to $80K or as high as $100K if two courses were employed/needed.The 20% co-pay of $16K or $20K is the question and the lower negotiated price from Canada or Mexico? The Medicare Part iDiot enacted by Bush Jr is just a gift to the pharma industry. Prior, I knew someone who had a liver transplant, however, I never got into the cost issue.
For the truly indigent, there is foundations or even Gilead has a philanthropic board. I’ve made cases to them and to ABC Amerisource Bergen who will absorb the cost if your defined indigent. Indigent is having nothing at all and no other means to pay. There is a quorum which must be convinced. If nothing else you get treated and a lien is put on your property, much like the nursing home enigma.
I attended the San Fran bio-tech and see their need to get billions due to the costs of a success and also to fund the dead ends. Prior I had considered reverse engineering and had some brilliant minds to help. I’ve been to MD Anderson and other institutions and there are many people who were still alive after exhausting the chemo/radiation, thereby they had nothing to lose in joining clinical trials. They are the fortunate ones and the government methodology needs to be sped up. Then again I’m very impatient.
Then you have a French drug maker who was exposed as nothing but greedy. Their bring down the price when bad press exposed them for who they are. Years ago they merged/bought out an orphan disease drug company and that was an area which, since these are few/rare cases, they lack economic incentive to work on.
So is America the nation which has the onus of R&D in the bio-tech industry? We are 5% of the earths population, yet we consume about 25% of the goods and services. The demographics are that 2K of our population, due to the baby-boom, retire everyday.
The solution is? We already have the technology and innovation, just awaiting the FDA approval. Hence, the economics is what needs to be solved. As these cures/treatments become even more expensive, we need to think outside of the box. Certainly HGH is what many believe will prolong life, yet bring the onset of the calamity/affliction sooner. If I remember at age 21 you start to lose a pound of lean mass each year. Younger people need to see what Peter Thiel of the PayPal group is betting his life on, this is rather interesting. Yet he is well off so we ought to and need. Cost sharing, which ZipCar and Uber might be the solution to the hub treatment facility. Hence, a secondary insurance to cover co-pays (a co-op of sorts to cover the means tested Medicare Part D shortcomings), negotiated rates with the big pharma and an active HGH lifestyle. Estimations of living 140 years need addressing?
Peter Thiel from the PayPal group!? Do you even know when did they sold PayPal? The “PayPal Mafia” are no longer affiliated to PayPal… Honestly, we all know economics follows definition of wealth and human behavior, but human behavior changed by application of cutting edge knowledge, tools and new ways of thinking and problem solving. Peter Thiel and people like him are few of those actual venture capitalist, you know, SENS foundation is just one of their “bet” and we all know its not enough. This SU post is more about HLI is using machine learning and computational power to crack our genetic code (you can think of them as big data of human biology in digital form) which is the ultimate and proper route to true human health and longevity for all human, HLI may eventually involved with a few drug industrial giants in the future, but the focus is not the legacy system like economics or FDA approval, its about new, better, faster way to tackle problems and push human race forward positively. When we all as people know, understands and using those data effectively and positively, legacy system follows.
I’m well aware that he and along with the others sold PayPal, Elon Musk included. They became wealthy and thereby we follow their exploits. Not to mention Ebay and PayPal are now split? I owned PayPal stock in 2015. Did you know that Peter is taking HGH and betting on a cure for cancer, since HGH brings on the cancer you would have gotten as you age. Thereby he is attempting to save/prolong his own life.
Defense Advanced Research Projects Agency (DARPA)
You fail to mention that the first genetic mapping of the fruit fly was done by university level research funding. The fruit fly has more in common with the human genetic code and thereby taxpayer funding has opened up the biotech industry, absent of private sector funding. The biotech field is innovation by many players and I’ve yet to come along any biotech concern who isn’t using big data as a tool.
“The human brain is one crazy computer, and while it’s been around for ages, there’s still a lot to learn about how it works. To that end, the Obama Administration is revving up to announce at ten-year plan to create a comprehensive map of the human brain, just like the one we have of the human genome. To know thyself, right?”
“It’s a promising proposition, considering how well the Human Genome project when down. Started in 1990 and costing around $3.8 billion, the project managed to get a comprehensive map created before the deadline, provided a solid base for further genetic research, and returned its investment over 100-fold. Likewise, a map of the human brain could be invaluable for the study of diseases like Alzheimer’s, autism, and schizophrenia. And who knows what else we might find in there.”
“According to scientists from some of the research institutes that will be involved in the project, there are a handful of government organizations involved as well, most notably DARPA, and planning meetings also included representatives from tech industry giants like Google, Microsoft, and Qualcomm.”
http://gizmodo.com/5985022/the-obama-administrations-10-year-plan-to-map-the-entire-human-brain
So back to the internet, created with taxpayers money, again. That certainly made PayPal/Ebay possible? Satellite/cable TV and cell phones are again large taxpayer funded industries? Composites used on the Shuttle nose cone and leading wing edges are also NASA innovation? Google was most interesting in that they used all three NASA/defense/university funded research?
“The development of the Google algorithms was carried on on a variety of Computers, mainly provided by the NSF-DARPA-NASA-funded Digital Library project at Stanford.”
http://infolab.stanford.edu/pub/voy/museum/pictures/display/0-4-Google.htm
Nate, that is the system, using taxpayer funded basic research innovation by the private sector. The private sector does indeed refine this, thereby providing the creature comforts and industries, at a profit. So why does a person such as Branson and Musk, still on the gov’t subsidy long after the technology is there? Both are from other nations, yet they have little or no skin in the game?
“Failure To Launch: How New Mexico Is Paying For Richard Branson’s Space Tourism Fantasy
One of the poorest states in the nation has invested nearly a quarter of a billion dollars and 10 years in creating a hub for Richard Branson’s space tourism company, Virgin Galactic. Some see it as the crown jewel of a new space age while others call it a carnival for the 1 percent — but with persistent delays and mounting financial strain, Spaceport America is just trying to avoid becoming New Mexico’s costliest, most futuristic ghost town.”
http://www.buzzfeed.com/jgwheel/failure-to-launch-how-new-mexico-is-paying-for-richard-brans#.ysm20DLmX
One might think that, with all of this reliance on the public coffers, an educated guess could be made as to Musk’s political leanings. It might come as a shock for some to learn that, politically, Musk seems to be most well-respected in libertarian circles, a demographic that is not comfortable with the idea of government handouts. The 2012 edition of the Atlas Summit, a conference for those who believe in the libertarian principles espoused by Ayn Rand, held a panel on SpaceX and the future of space travel during which panelists couldn’t help but draw parallels between Musk and John Galt, the protagonist of Rand’s Atlas Shrugged. In 2012, almost half of Musk’s $74,200 total political campaign contributions went to Obama Victory Fund 2012 but he also spent thousands of dollars on Republican candidates like former U.S. Senator Scott Brown, Congressman Dana Rohrabacher (R-CA) and Sen. Marco Rubio (R-FL). In 2014, Musk’s two biggest donations went to the National Republican Congressional Committee ($32,400) and a campaign fund for Sen. Kevin McCarthy (R-CA) ($30,000). Yet there were significant members of the Democratic Party receiving campaign contributions from Musk, including Sen. Cory Booker (D-NJ), Sen. Dick Durbin (D-IL) and Congressman Dutch Ruppersberger (D-MD). Musk certainly wants to fashion himself as a realist but, ultimately, he is a pragmatist who is very good at picking winners.
What’s most troubling to us here at IPWatchdog is the fact that Musk is trying to make a loser out of the American patent system. We’ve reported on Musk’s negative view of patents, which he has portrayed as stumbling blocks that get in the way of truly meaningful innovation. Many of our readers will know that nothing could be further from the truth. As we discussed, many of Musk’s ventures have continued to apply for patents even though he maintains that he has avoided patenting any technology since he left Zip2, a former business venture, in 1999. Once again, the pragmatic Musk has been able to paint himself as Musk the idealist in a very successful manner.
Applying for a patent to bring a useful innovation to the commercial market is an honest and open way to create personal wealth in the United States. Tesla co-founder and former CEO Martin Eberhard has suggested that the government subsidies received by Elon Musk haven’t been vital for their survival, to be sure, but they’ve allowed Musk to grow his businesses into incredibly profitable empires within a few years’ time. They’ve also allowed Musk to protect his personal share of his companies without having to dilute his share of corporate holdings to grow his personal capital.
http://www.ipwatchdog.com/2015/06/07/government-subsidies-helped-elon-musk/id=58427/
Having come from the military industrial complex, we developed self driving years ago. We all said the Elon was launching old Russian rockets, we saw them and knew that wasn’t anything new.
Yet more to the topic of big data, our programs have for years come from serves at the developers ultra secured sites. The genetic code for humans has been cracked for over ten years now and the venture/vulture capitalist are already in the space. Last I checked, it was about $2K to obtain your genetic code. Then invitro is being used to mate the ideal, genetically superior female/male reproductive material. I think a patent is in force and about 3000 births last year in this manner. This of all the defective genetic material ending breast cancer and a hot of other human afflictions.
“There are few fields of medicine that are having a bigger impact on how we treat disease than genetics. The science of genetics has gotten so sophisticated so quickly that it can be used to not only treat serious diseases but prevent thousands of them well before pregnancy even begins. Diseases that have stalked families for generations – like breast cancer – are being literally stopped in their tracks. Scientists can do that by creating and testing embryos in a lab, then implanting into a mother’s womb only the ones which appear healthy. While the whole field is loaded with controversy, those who are worried about passing on defective and potentially dangerous genes see the opportunity to breed out disease.
Norah O’Donnell: Did you ever envision that you would have the capability you have today?
Dr. Mark Hughes: No, but that’s the fun of science. It’s constantly surprising you.”
http://www.cbsnews.com/news/breeding-out-disease-with-reproductive-genetics/
Dr. Mark Hughes patent includes the aesthetic and other traits. All I want to know when this is affordable to the masses at $16K per birth? Thousands of diseases are excluded from the odds of having a defective condition with about 6 billion big data calculations made. Small molecule is also refined and ready to go. Vaccination is also refined and ready to go. Plasma freezes from survivors anti-bodies are also ready to go. Modified RNA compounds are already to go.
The only new thing being fast tracked is microbiome therapeutics platform company Seres, which focuses on the development of biological drugs designed to restore health by repairing the function of a dysbiotic microbiome. These are thought to being the reason of hospital infections.
Nate, seriously the code has been cracked for more than ten years now. We need to move on.
http://www.nobelprize.org/educational/medicine/gene-code/history.html
The human genome is 3.2 Gbp in size. The first element of every basepair can have four different values: A,C,G or T, determining the value of the other. Even without compression, this can be encoded in 6.4 Gbit i.e. 0.8 gigabyte. When each element is an ASCII encoded character, this will be 3.2 GB, not 300 gigabyte. One hundred times less.
The epigenetic information will increase this slightly; the microbiome by an unknown amount. The average bacterium carries about 0.14-11 MBp; around 500-1000 bacterial species are estimated to inhabit the human gut. The commensal gut protozoa and fungi will, of course, have a larger genome. The scans, health data however, will gobble up lots of storage space. Indeed, the total size of a complete medical record as described by Mr Diamandis can well be in excess of 300 GB.
It is definitely a worthy endeavour and I hope that many talented and well-funded people will join it. Be, however, prepared for some surprises down the road. There are still several aspects of human physiology and cell metabolism that we do not understand well yet. Who knew about epigenetics fifteen years ago?
and newly discovered base pairs.. who knows what else is there that we don’t know. even the gross anatomy we thought we already knew is getting discoveries like the lymphatic system connection to the brain.
Right, it is 6 GB overall including the shape of the DNA, how come 300 GB I cannot understand.
Illumina, Inc. provides sequencing and array-based solutions for genetic analysis in North America, Europe, Latin America, the Asia-Pacific, the Middle East, and South Africa. The company’s products include sequencing platforms that are based on its SBS technology, which provides researchers with various ranges of applications and the ability to sequence mammalian genomes; and array platforms consist of HiScan and iScan systems, as well as NextSeq 550 system that are array scanners for DNA and RNA analysis applications, including single nucleotide polymorphism genotyping, copy number variations analysis, gene expression analysis, and methylation analysis. It also offers various library preparation and sequencing kits to simplify workflows and accelerate analysis. In addition, the company provides genotyping, noninvasive prenatal test, and whole-genome sequencing services. It serves genomic research centers, academic institutions, government laboratories, hospitals, and reference laboratories, as well as pharmaceutical, biotechnology, agrigenomics, commercial molecular diagnostic, and consumer genomics companies. The company sells its products directly, as well as through distributors. It has a collaboration agreement with Merck Serono to develop a sequencing-based oncology diagnostic. Illumina, Inc. was founded in 1998 and is headquartered in San Diego, California.
BUSINESS WIRE – 7:00 AM ET 06/08/2015
Illumina, Inc. ( ILMN
today announced the formation of the Global Fertility Alliance, a new collaboration to advance excellence in fertility technologies and processes within the assisted reproductive treatment laboratory. The alliance aims to improve the consistency in ART worldwide and addresses the need for more standardization of fertility processes within the ART laboratory.
“Illumina is encouraged by the Obama Administration’s proposed precision medicine initiative that will use personalized genetic information to help treat diseases like cancer and diabetes. With the cost of sequencing an entire human genome recently lowered to $1,000, advances in genomic medicine are now more accessible. We applaud an endeavor of this magnitude and recognize this is a significant step toward realizing the full potential of unlocking the power of the genome to improve public health and wellness.”
http://www.illumina.com/
Intrexon Corporation, a biotechnology company, operates in the synthetic biology field in the United States. The company, through a suite of proprietary and complementary technologies, designs, builds, and regulates gene programs, which are DNA sequences that consist of key genetic components. Its technologies include UltraVector gene design and fabrication platform, and its associated library of modular DNA components; cell systems informatics; RheoSwitch inducible gene switch; AttSite Recombinases; protein engineering; mAbLogix; and laser-enabled analysis and processing. Intrexon Corporation has collaboration agreements with ZIOPHARM Oncology, Inc.; Synthetic Biologics, Inc.; Oragenics, Inc.; Fibrocell Science, Inc.; Genopaver, LLC; AquaBounty Technologies, Inc.; S & I Ophthalmic, LLC; Biological & Popular Culture, Inc.; OvaXon, LLC; Intrexon Energy Partners, LLC; and Persea Bio, LLC; and strategic collaboration and licensing agreement with Merck Serono S.A. The company was formerly known as Genomatix Ltd. and changed its name to Intrexon Corporation in 2005. Intrexon Corporation was founded in 1998 and is based in Germantown, Maryland.
The University of Texas MD Anderson Cancer Center has established a broad exclusive licensing agreement with Intrexon Corporation and ZIOPHARM Oncology, both of which are focused on the development of non-viral adoptive cellular cancer immunotherapies. MD Anderson’s new agreement with the companies includes an exclusive sub-licensing for intellectual property designed at the University of Minnesota.
The terms of the agreement stipulate a $100 million payment, half from Intrexon and the other half from ZIOPHARM, in shares of their common stocks, in addition to three years of payments between $15 and $20 million granted annually to support the research, which will be conducted at MD Anderson Cancer Center’s facilities.
http://bionews-tx.com/news/2015/02/02/md-anderson-partners-with-intrexon-and-ziopharm-on-t-cell-immunotherapies/
An enormous undertaking. I look forward to following this company’s progress.
I’m surprised epigenetic markers aren’t listed as part of the “integrated health record”.They will undoubtedly play an important role in statistical associations between genome and metabolome.
Excellent question and your right. 3000 people with about $20K had their offspring/DNA tested and had children via in vitro fertilization. I hope the cost is going to come down and are whole society benefits. Rarely do we see someone who suffers with polio? Each child with an affliction which could have been avoided is on them.
I personally do not care for the in vitro fertilization, pleasure wise, however a single cell tells all and the A C T G coding defects can be mapped out, with the use of a computer, omitted. Could end a genetic breast cancer for generations is just one of the many affliction. These university/taxpayer funded people have patents and they intend to cash in. This year they will do 5000 or more wealthy people.$$$$
Taking full use of computer science, much time and energy can be saved in doing biological related researches.This post shows a good example of that.
Candy Swift
Creative Biolabs
http://www.creative-biolabs.com/antibody-production-through-DNA-immunization-genetic-immunization.html
This is 2015 and the bio-techs have come a long way. Back in 66 they still said she fell and thereby broke her pelvis. We now know that her pelvis broke and then she fell. The notion that calcium supplements aren’t absorbed unless some weight bearing activity is now common knowledge too.
That being said the out break of Staphylococcus in antiseptic hospitals environments have now been seen more of poor immune systems. However, even if steroid treatment aren’t able to boost the immune system, we have means to turbo charging it with cultured stem cells and cancer initiating cells. oncolytic adenoviruses have been shown to effectively kill cancer cells, by seizing control of their DNA replication machinery and utilizing it for the production of new virions, and thereby targeting the adenoviral genome. Use of the virotherapy for killing tumor-initiating cells is one of many more to come.
First vaccines is a promising area of the bio-tech.
Modification of RNA virus compounds, which inhibit the RNA chemically identify inhibitors.
Small molecules in enzyme’s and allosteric enzymes displaying a sigmoidal dependence are an opening to molecularly targeted cancer drug discovery and development may result in an increasing number of successful therapies that have impacted the lives of a large number of cancer patients and or those who carry a genetic predisposition to the breast cancers. The identification and characterization of these unique small-molecule activators.
Lastly there are the anti-bodies of plasma freezes from prior survivors.
As long as the cost effectiveness makes it possible for everyone.
http://killingcancer.vice.com/
http://www.hbo.com/vice/episodes/03/00-vice-special-report-killing-cancer/video/clip-vice-special-report-killing-cancer.html?autoplay=true
The combination of computer science and genetic will lead biotechnology to a new revolution. That’s genius.
http://www.cd-genomics.com
This link from the BBC may be helpful
http://www.bbc.co.uk/news/health-34153135
and this as a source for your headhunting:
https://uk.linkedin.com/pub/james-timmons/3/422/179