<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	>

<channel>
	<title>Singularity Hub &#187; dna</title>
	<atom:link href="http://singularityhub.com/tag/dna/feed/" rel="self" type="application/rss+xml" />
	<link>http://singularityhub.com</link>
	<description>The Future Is Here Today...Robotics, Genetics, AI, Longevity, The Brain...</description>
	<lastBuildDate>Thu, 09 Feb 2012 16:09:46 +0000</lastBuildDate>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	<generator>http://wordpress.org/?v=3.1.4</generator>
		<item>
		<title>Latest Victory For Regenerative Medicine: Pituitary Grown From Embryonic Stem Cells</title>
		<link>http://singularityhub.com/2011/12/16/latest-victory-for-regenerative-medicine-pituitary-grown-from-embryonic-stem-cells/</link>
		<comments>http://singularityhub.com/2011/12/16/latest-victory-for-regenerative-medicine-pituitary-grown-from-embryonic-stem-cells/#comments</comments>
		<pubDate>Fri, 16 Dec 2011 15:48:52 +0000</pubDate>
		<dc:creator>Peter Murray</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[Longevity And Health]]></category>
		<category><![CDATA[Singularity]]></category>
		<category><![CDATA[Stem Cells]]></category>
		<category><![CDATA[brain]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[genes]]></category>
		<category><![CDATA[medicine]]></category>
		<category><![CDATA[pituitary]]></category>
		<category><![CDATA[regenerative medicine]]></category>
		<category><![CDATA[RIKEN]]></category>
		<category><![CDATA[yoshiki sasai]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=43171</guid>
		<description><![CDATA[Chalk up another part of the body that can be grown from stem cells – at least in mice. Scientists [...]]]></description>
			<content:encoded><![CDATA[<div id="attachment_43172" class="wp-caption alignleft" style="width: 310px"><a href="http://singularityhub.com/wp-content/uploads/2011/12/sasai.jpg"><img class="size-full wp-image-43172" title="sasai" src="http://singularityhub.com/wp-content/uploads/2011/12/sasai.jpg" alt="" width="300" height="220" /></a><p class="wp-caption-text">Yoshiki Sasai&#39;s group induced embryonic stem cells to grow into the three-dimensionally complex pituitary.</p></div>
<p>Chalk up another part of the body that can be grown from stem cells – at least in mice. Scientists in Japan have induced mouse embryonic stem cells to form a pituitary in the lab. The team’s success not only holds promise for people with pituitary defects, but it’s another of just a few examples in which stem cells have been coaxed into a complex, three dimensional structure.</p>
<p>The <a href="http://www.umm.edu/endocrin/pitgland.htm">pituitary</a> is often referred to as the “master” gland of the endocrine system, as it secretes hormones that control the hormones secreted by other endocrine glands. It’s formation during embryonic development is closely tied to the <a href="http://en.wikipedia.org/wiki/Hypothalamus">hypothalamus</a>, another important endocrine structure located close by at the base of the brain. The challenge to the Japanese researchers was to maintain the proper developmental environment for the nascent pituitary outside the brain. It was a complex challenge. They added hypothalamus tissue to the mix so that the stem cells would receive guiding signals from it, but the brain obviously consists of much more than these two areas. In order to “trick” the pituitary into thinking it was still in the brain, they also added several growth-inducing molecules including <a href="http://en.wikipedia.org/wiki/Sonic_hedgehog">Sonic Hedgehog</a> (it was discovered by a graduate student back when the game was popular) that are required for proper development in the brain. It worked. In just a couple weeks, the new structure not only looked like a pituitary, it produced all the major molecular markers that a normal pituitary produces. For the icing on the cake, the researchers placed the lab-grown pituitary into mice which had their own pituitaries destroyed. A week after transplantation, the mice showed increased blood levels of hormones produced by the pituitary.</p>
<p>The study was led by <a href="http://www.cdb.riken.jp/sasai/index-e.html">Yoshiki Sasai</a> at the Riken Institute in Japan and was published in <a href="http://www.nature.com/nature/journal/v480/n7375/full/nature10637.html">Nature</a>.</p>
<div id="attachment_43173" class="wp-caption alignleft" style="width: 310px"><a href="http://singularityhub.com/wp-content/uploads/2011/12/image11.jpg"><img class="size-full wp-image-43173" title="image1" src="http://singularityhub.com/wp-content/uploads/2011/12/image11.jpg" alt="" width="300" height="220" /></a><p class="wp-caption-text">The same researchers had previously used embryonic stem cells to from layers of the brain cortex.</p></div>
<p>The pituitary hormones regulate important physiological processes such as growth, puberty, and reproduction. A dysfunctional pituitary can lead to deficits in these hormones, which in turn can <a href="http://www.nature.com/nature/journal/v480/n7375/full/480044a.html">lead to disorders</a> such as stunted growth, hypothyroidism, and infertility. Combined pituitary hormone deficiency affects about 1 in 3,000 to 4,000 live births. And although hormone-replacement therapy can be effective for many, it does not return hormone levels to their normal levels.</p>
<p>But don’t expect doctors to start replacing dysfunctional pituitaries with ones grown in the lab anytime soon. Most importantly, we’ll first need to see if the procedure can be repeated with human embryonic stem cells. And even now questions remain regarding the lab-grown mouse pituitaries. Embryonic stem cells differentiated in the lab don’t always run the course to full maturity. The pituitary in the current study still looks like the pituitary from an embryo. Only time will tell whether or not it can develop to an adult pituitary. But even if we can’t start swapping out dysfunctional pituitaries, the lab-grown structures should be a valuable tool for researchers studying pituitary defects. They can be looked at under a microscope and labeled with molecular markers, lending themselves to analyses far more difficult to perform in whole animals.</p>
<p>It could also pave the way for future stem cell research. The pituitary’s development in the study, as it is in normal development, was dependent on molecular signals sent from the hypothalamus. Now that the researchers have established that it is possible to run this inductive process, they have opened the door for the induction of even more complex organs in the lab.</p>
<p>The victories for regenerative medicine just keep on coming. Last year a group at UC Irvine in California successfully <a href="http://singularityhub.com/2010/06/07/hans-keirstead-transforms-embryonic-stem-cells-into-retinas/">grew a retina</a> from human embryonic stem cells. Like the pituitary, the retina needed to be grown with a specific three-dimensional organization in order to function properly. The starting clumps of stem cells required no intervention from the scientists to become retinas. The cell-to-cell communication during “development” was all they needed. Sasai’s group also induced embryonic stem cells to <a href="http://www.nature.com/news/2011/110406/full/news.2011.215.html">form a retina</a> this past spring, although theirs was grown from mouse cells.</p>
<p>The group is currently working to improve transplantation of pituitary tissue in their mouse model. They&#8217;re also working on methods to repeat the experiment with human stem cells. Sasai expects it will be about three years to create a human pituitary. When they do, the field of regenerative medicine will be that much closer to its holy grail of growing all organs in the lab and transplanting them into humans.</p>
<p>[image credits: RIKEN]<br />
image 1: <a href="http://www.cdb.riken.jp/en/02_research/0201_core05.html">cortex</a><br />
image 2: <a href="http://www.cdb.riken.jp/en/04_news/articles/10/100917_sasaiprize.html">Sasai</a></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/06/07/hans-keirstead-transforms-embryonic-stem-cells-into-retinas/" rel="bookmark"><img width="200" height="148" src="http://singularityhub.com/wp-content/uploads/2010/06/hans-keirstead.jpg" class="crp_thumb wp-post-image" alt="Hans Keirstead Transforms Embryonic Stem Cells Into Retinas" title="Hans Keirstead Transforms Embryonic Stem Cells Into Retinas" border="0" /></a> <a href="http://singularityhub.com/2010/06/07/hans-keirstead-transforms-embryonic-stem-cells-into-retinas/" rel="bookmark" class="crp_title">Hans Keirstead Transforms Embryonic Stem Cells Into Retinas</a></li><li><a href="http://singularityhub.com/2010/02/02/mouse-skin-into-neurons-without-need-for-pluripotent-stem-cells/" rel="bookmark"><img width="200" height="147" src="http://singularityhub.com/wp-content/uploads/2010/02/mouse-skin-neurons.jpg" class="crp_thumb wp-post-image" alt="Mouse Skin Into Neurons Without Need for Pluripotent Stem Cells" title="Mouse Skin Into Neurons Without Need for Pluripotent Stem Cells" border="0" /></a> <a href="http://singularityhub.com/2010/02/02/mouse-skin-into-neurons-without-need-for-pluripotent-stem-cells/" rel="bookmark" class="crp_title">Mouse Skin Into Neurons Without Need for Pluripotent Stem Cells</a></li><li><a href="http://singularityhub.com/2010/05/13/uc-irvine-stem-cell-research-center-set-to-launch-on-friday/" rel="bookmark"><img width="200" height="145" src="http://singularityhub.com/wp-content/uploads/2010/05/sue-bill-gross-hall.jpg" class="crp_thumb wp-post-image" alt="UC Irvine Stem Cell Research Center Set to Launch on Friday" title="UC Irvine Stem Cell Research Center Set to Launch on Friday" border="0" /></a> <a href="http://singularityhub.com/2010/05/13/uc-irvine-stem-cell-research-center-set-to-launch-on-friday/" rel="bookmark" class="crp_title">UC Irvine Stem Cell Research Center Set to Launch on Friday</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2011/12/16/latest-victory-for-regenerative-medicine-pituitary-grown-from-embryonic-stem-cells/feed/</wfw:commentRss>
		<slash:comments>3</slash:comments>
		</item>
		<item>
		<title>Report: Baby&#8217;s Sex Can Be Determined With Mother&#8217;s Blood At Seven Weeks</title>
		<link>http://singularityhub.com/2011/08/18/report-babys-sex-can-be-determined-with-mothers-blood-at-seven-weeks/</link>
		<comments>http://singularityhub.com/2011/08/18/report-babys-sex-can-be-determined-with-mothers-blood-at-seven-weeks/#comments</comments>
		<pubDate>Thu, 18 Aug 2011 16:04:16 +0000</pubDate>
		<dc:creator>Peter Murray</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[Longevity And Health]]></category>
		<category><![CDATA[Singularity]]></category>
		<category><![CDATA[blood]]></category>
		<category><![CDATA[China]]></category>
		<category><![CDATA[diana bianchi]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[gender tests]]></category>
		<category><![CDATA[medicine]]></category>
		<category><![CDATA[pink and blue]]></category>
		<category><![CDATA[tufts university]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=40056</guid>
		<description><![CDATA[Want to find out if your baby is going to be a boy or a girl but aren’t sure about [...]]]></description>
			<content:encoded><![CDATA[<div id="attachment_40059" class="wp-caption alignleft" style="width: 310px"><a href="http://singularityhub.com/wp-content/uploads/2011/08/image14.jpg"><br />
<img class="size-full wp-image-40059" title="image1" src="http://singularityhub.com/wp-content/uploads/2011/08/image14.jpg" alt="" width="300" height="220" /></a><p class="wp-caption-text">New study shows that blood-based gender tests performed in medical labs are 95% accurate, but says nothing about direct-to-consumer testing.</p></div>
<p>Want to find out if your baby is going to be a boy or a girl but aren’t sure about what test to use? A new study shows that simple, non-invasive blood tests are highly accurate as early as seven weeks of pregnancy. By comparison, ultrasound requires at least 13 weeks to reach the same level of accuracy. But don’t go and grab the first blood test you find online. The study evaluated tests performed in medical labs, and even though companies typically use the same methods, the accuracy of direct-to-consumer tests have yet to be evaluated.</p>
<p>Fetal sex determination is typically determined with a quick and noninvasive ultrasound. But at 11 weeks ultrasounds <a href="http://www.ncbi.nlm.nih.gov/pubmed/19099612">get it wrong 40 percent of the time</a>, although by 13 weeks its accuracy approaches 100 percent. The current study, led by Tufts University’s <a href="http://www.tufts.edu/sackler//facultyIntros/bianchiD.html"> Diana Bianchi</a> and <a href="http://jama.ama-assn.org/content/306/6/627.short">published this month</a> in the Journal of the American Medical Association, sought to determine how blood-based gender tests measured up. The results were impressive. They compiled data from 57 studies that measured the accuracy of lab-based gender testing. Of the over 6,500 pregnancies included in the studies, the tests determined sex with an accuracy of 95 percent at 7 weeks and 99 percent at 20 weeks. The researchers also evaluated the accuracy of urine-based tests. With inaccuracy rates as high as 24 percent, they concluded that urine-based tests were unreliable.</p>
<p>How can a baby’s gender be detected in the mother’s blood? During gestation, some of the baby’s DNA will mix into the mother’s blood. After isolating the DNA, technicians can test for the male-specific Y-chromosome. Because the mother doesn’t carry a Y-chromosome herself, detecting one would indicate she’s carrying a boy. One source of inaccuracy, however, are cases in which no Y-chromosome is detected and it’s concluded that the baby is a girl. But absence of proof is not proof of absence – failure to detect a Y-chromosome could simply mean sufficient amounts of the baby boy’s DNA is not present in the mother’s bloodstream. The baby’s DNA collects in the bloodstream over time, accounting for increased gender-test accuracy at later weeks of gestation.</p>
<p>The study comes at a time when online genetics test are a burgeoning industry. Since the human genome was <a href="http://www.ornl.gov/sci/techresources/Human_Genome/project/hgp.shtml">sequenced in 2003</a> companies peddling at-home genetics tests have exploded onto the scene that claim to read our DNA and <a href="http://articles.latimes.com/2008/feb/24/science/sci-gender24">give us information</a> on our ethnic heritage, family tree, what foods we should eat to stay healthy – even the sport we&#8217;re best fit to play. Not to be left behind during the genomics boom, many companies are also spinning out tests to reveal to excited parents just what to expect. Then they can tell their friends, think of a name, buy trucks instead of dolls and paint the room blue.</p>
<p>Except, it doesn’t always work out as planned.</p>
<p>After spending $300 on a screen, Rohit and Geeta Jain were told to expect a baby boy. The testing company claimed to be 95 percent accurate. When their precious little baby girl was born six months later they were stunned. Rohit <a href="http://articles.latimes.com/2008/feb/24/science/sci-gender24">told the LA Times</a>, “There’s only two choices – either it’s a boy or a girl. I couldn’t fathom how it could be wrong.”</p>
<p>One could fathom how it could be wrong, were it wrong only 5 percent of the time. But while the direct-to-consumer gender testing business as a whole hasn’t undergone the sort of evaluation that Bianchi’s group performed, there are signs abound that parents-to-be may just want to hold off on painting that nursery just yet. Cases like the Jains’ are all too common. In 2005 Acu-Gen Biolab offered the Baby Gender Mentor test. Featured on the Today Show and Newsweek, the company claimed that their test was 99.9 percent accurate. In 2009 the company <a href="http://www.boston.com/Boston/dailydose/2011/08/early-pregnancy-blood-test-can-reliably-screen-for-gender-should-used/TwYyDvFcIHkZ4T1b6wFASP/index.html">filed for bankruptcy</a> as a result of a class action lawsuit against hundreds of women who had been refused a refund after the test turned out to be wrong.</p>
<p>The Federal Trade Commission has <a href="http://www.ftc.gov/bcp/edu/pubs/consumer/health/hea02.shtm">issued a warning</a> to consumers to be skeptical of at-home genetics tests in general, as “some of these tests lack scientific validity.” LA Times science writer Karen Kaplan mentions that scientists view the tests as “the latest incarnation of old wives’ tales about salty food cravings, hairy legs and belly shapes denoting the sex of the impending baby. This time, the predictions are being sold with the patina of cutting-edge genetic technology.”</p>
<p>Blood-based gender testing is already being <a href="http://www.nytimes.com/2011/08/10/health/10birth.html">performed routinely</a> by doctors in the Netherlands, the UK, France, and Spain use the tests routinely to determine if the baby needs to be tested further for gender-linked disorders. For example, Duchenne muscular dystrophy, a genetic disorder that results in the rapid weakening of muscles, overwhelmingly affects males. If it is determined that the baby is a girl then the costly genetic test for muscular dystrophy can be ruled out.</p>
<p>But some countries don’t look at gender testing as a convenience or health measure. <a href="http://articles.latimes.com/2008/feb/24/science/sci-gender24">Research has shown</a> that in both India and China the tests are increasingly being used to select for males – baby girls are being aborted. Consumer Genetics Inc., the makers of the blood test “Pink or Blue” requires women to sign a consent form agreeing not to use the tests for gender selection. Also, the company refuses to sell its kits to customers in China or India.</p>
<p>Direct-to-consumer genetic tests, including gender tests, will continue to multiply as the genomics boom continues. As of 2008 there were approximately <a href="http://articles.latimes.com/2008/feb/24/science/sci-gender24">1,400 tests on the market</a>. Still none of them are regulated by the FDA, which means the buyer better beware. Even the relatively simple detection of a Y-chromosome can go awry. Although the overall accuracy of the tests included in the current study was very high, the researchers saw a lot of variability. Despite the tests being carried out in bona fide medical labs there were still some that were simply not as accurate as others. The technology is there and the study shows that on average the professionals know how to use it. With blood tests, parents eager to have their baby’s sex don’t have to wait 13 weeks. But until governments formulate a plan to evaluate and regulate direct-to-consumer tests, it’s probably best to have that test in the clinic.</p>
<p>[image credits: Healthfiend]<br />
image: <a href="http://www.healthfiend.com/info/blood-test-determines-baby%E2%80%99s-gender-after-seven-weeks-of-pregnancy/">Healthfiend</a></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2009/06/10/gender-test-for-unborn-children-now-possible-even-earlier/" rel="bookmark"><img width="200" height="150" src="http://singularityhub.com/wp-content/uploads/2009/06/intelligender.jpg" class="crp_thumb wp-post-image" alt="Gender Test for Unborn Children Now Possible Even Earlier" title="Gender Test for Unborn Children Now Possible Even Earlier" border="0" /></a> <a href="http://singularityhub.com/2009/06/10/gender-test-for-unborn-children-now-possible-even-earlier/" rel="bookmark" class="crp_title">Gender Test for Unborn Children Now Possible Even Earlier</a></li><li><a href="http://singularityhub.com/2011/04/12/is-aged-based-hivaids-testing-the-key-to-stamping-out-the-disease/" rel="bookmark"><img width="200" height="149" src="http://singularityhub.com/wp-content/uploads/2011/04/hiv-test.jpg" class="crp_thumb wp-post-image" alt="Is Aged-Based HIV/AIDS Testing the Key to Stamping Out the Disease?" title="Is Aged-Based HIV/AIDS Testing the Key to Stamping Out the Disease?" border="0" /></a> <a href="http://singularityhub.com/2011/04/12/is-aged-based-hivaids-testing-the-key-to-stamping-out-the-disease/" rel="bookmark" class="crp_title">Is Aged-Based HIV/AIDS Testing the Key to Stamping Out the Disease?</a></li><li><a href="http://singularityhub.com/2009/06/11/test-for-cancer-with-a-take-home-kit/" rel="bookmark"><img width="200" height="147" src="http://singularityhub.com/wp-content/uploads/2009/06/cancer-qun-huo.jpg" class="crp_thumb wp-post-image" alt="Test for Cancer With a Take-Home Kit" title="Test for Cancer With a Take-Home Kit" border="0" /></a> <a href="http://singularityhub.com/2009/06/11/test-for-cancer-with-a-take-home-kit/" rel="bookmark" class="crp_title">Test for Cancer With a Take-Home Kit</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2011/08/18/report-babys-sex-can-be-determined-with-mothers-blood-at-seven-weeks/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
		</item>
		<item>
		<title>Chinese Scientists Clone Cows With &#8220;Humanized&#8221; Milk</title>
		<link>http://singularityhub.com/2011/04/20/chinese-scientists-clone-cows-with-humanized-milk/</link>
		<comments>http://singularityhub.com/2011/04/20/chinese-scientists-clone-cows-with-humanized-milk/#comments</comments>
		<pubDate>Wed, 20 Apr 2011 14:39:02 +0000</pubDate>
		<dc:creator>Peter Murray</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[China]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[genes]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=32916</guid>
		<description><![CDATA[This very moment, grazing in the fields of the State Key Laboratory of Agrobiotechnology in Beijing, China is a particular [...]]]></description>
			<content:encoded><![CDATA[<p><a href="http://singularityhub.com/wp-content/uploads/2011/04/cowbottle.jpg"><img class="alignleft size-full wp-image-32917" title="cowbottle" src="http://singularityhub.com/wp-content/uploads/2011/04/cowbottle.jpg" alt="" width="220" height="300" /></a>This very moment, grazing in the fields of the State Key Laboratory of Agrobiotechnology in Beijing, China is a particular heard of about 300 cows. Each one is a clone, and each one produces milk that contains proteins normally found in human milk. The cows are part of a vision belonging to Ning Li, SKYLAB’s director, to put “human-like milk” onto supermarket shelves–and into baby bottles–all over the world.</p>
<p>As <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0017593" target="_blank">published in the Public Library of Science One</a>, the cows were cloned by <a href="http://en.wikipedia.org/wiki/Somatic_cell_nuclear_transfer" target="_blank">somatic cell nuclear transfer</a>–the same method Ian Wilmut used to clone Dolly–in which the nucleus of a somatic (body) cell is transferred into an egg that has had its nucleus removed. Prior to inserting the somatic nucleus into the enucleated egg, Dr. Li’s group infected it with a virus carrying the human gene for lysozyme. <a href="http://en.wikipedia.org/wiki/Lysozyme" target="_blank">Lysozyme</a> is an enzyme found in large quantities in human breast milk that can lyse–or split open–the cell walls of harmful bacteria in the gut. In addition to its antibacterial effects, lysozyme works to boost the body’s immune response to infection. The immunological benefits imparted by lysozyme is an important reason why breast milk is so healthy for developing babies. It’s absent in most of the baby formulas commonly-used to supplement or substitute breast milk. Compared with the 200-400 μg/ml concentration found in human breast milk, cow milk normally contains lysozyme at 0.05-0.22 μg/ml. The milk from Dr. Li’s cows increased their lysozyme concentrations more than a hundred-fold to 26 μg/ml.</p>
<p>In addition to lysozyme, Dr. Li’s group successfully cloned cows that produce milk containing two additional human proteins, called lactoferrin and alpha-lactalbumin, both of which strengthen the baby’s immune system. Like lysozyme, these proteins are found in normal cow milk but increasing their amounts will provide a further boost to the baby’s immune system. On top of that the cow benefits as well. The human genes will help protect the cow’s udder from infection, possibly decreasing the need for feeding the animals antibiotics, a major contributor to the <a href="http://singularityhub.com/2011/04/18/hold-spread-of-antimicrobial-resistance-causes-who-to-declare-the-world-is-on-the-brink/" target="_blank">harrowing pattern of antibiotic resistance that is spreading worldwide</a>.</p>
<p>In addition, the SKYLAB scientists made the cow milk more human-like in other ways. They increased milk fat content by about 20 percent and changed the concentrations of certain milk solids to more closely match the concentrations found in human milk. The group victoriously proclaimed that their demonstration proves that it is possible to “humanize” cow milk.</p>
<p>So when should we expect to find the cow-produced, human-like milk to show up at a supermarket near us? Dr. Li, collaborating with a Beijing company called GenProtein Biotechnology Company, projects it’ll take about ten years until the milk is made available to the public. How palatable consumers find the humanized milk is anybody’s guess at this point. The <a href="http://www.chinadaily.com.cn/china/2011-03/22/content_12205575.htm" target="_blank">ChinaDaily reported</a> that Dr. Li describes the milk as having a “stronger” taste than normal milk–but he didn’t specify normal cow milk or normal breast milk. We’ll just have to wait and see, I guess.</p>
<div id="attachment_32918" class="wp-caption alignleft" style="width: 310px"><a href="http://singularityhub.com/wp-content/uploads/2011/04/Holstein_cows_large.jpg"><img class="size-full wp-image-32918" title="Holstein_cows_large" src="http://singularityhub.com/wp-content/uploads/2011/04/Holstein_cows_large.jpg" alt="" width="300" height="220" /></a><p class="wp-caption-text">The researchers claim that the Holstein cows used in the study produced &quot;humanized&quot; milk but were otherwise normal.</p></div>
<p>Probably more important than taste, much of the West is still weary–if not outright hostile–to the idea of GM foods. Countries of the European Union are <a href="http://www.gmwatch.org/latest-listing/1-news-items/12660-eurobarometer-more-europeans-opposed-to-gm-food" target="_blank">especially incensed</a>–61% of Europeans are opposed to GM foods. As <a href="http://online.wsj.com/article/SB10001424052748704476604576158230363494712.html" target="_blank">suggested by the Wall Street Journal</a>, however, the increasing costs of non-GM food imports may cause Europeans to soon change their tune. Obviously, GM foods don’t face the same opposition in China which is moving rapidly towards the <a href="http://singularityhub.com/2011/03/23/future-of-genetically-modified-ricecorn-in-china-may-be-both-certain-and-delayed/" target="_blank">commercial use of genetically-modified foods</a> such as rice and corn. The fact that they were able to combine two techniques that are still controversial in the West–GM and animal cloning–with the public visibility that they did is indicative of a country that is ready to take the lead on this area of research, and reap all of the economic benefits that will inevitably follow. Dr. Li alludes to this in the paper, saying, “Thus, our study not only describes transgenic cattle whose milk offers the similar nutritional benefits as human milk but also reports techniques that could be further refined for production of active human lysozyme on a large scale.”</p>
<p>If you’re totally grossed out by the idea of putting human genes into animals you should know that Dr. Li’s cows are far from the first organisms to have human genes and produce human proteins. Since the <a href="http://www.time.com/time/magazine/article/0,9171,916401,00.html" target="_blank">1980s we’ve cultured the bacteria</a>, E. coli, carrying the human gene for insulin (a protein). The easily mass-produced and purified insulin from bacteria was an improvement over the purified cow insulin we’d been using up until then to treat persons suffering from type 2 diabetes. Soon thereafter we enlisted the help of E. coli to produce human growth hormone. But bacterial systems are limited in their capacity to correctly fold and modify the comparably complex proteins produced by mammals. Because of this mammalian systems have been developed to express our mammalian genes. Human antithrombin III has been grown up and purified from farm animal milk; the human antibody interferon β1a has been grown up in chicken egg whites. To date the <a href="http://www.ncbi.nlm.nih.gov/pubmed/18243312" target="_blank">list of human genes grown in these and other mammalian systems</a> includes monoclonal antibodies, blood factors, hormones, growth factors, cytokines, enzymes, milk proteins, collagen and fibrinogen.</p>
<p>Add to the list human lysozyme produced in cow milk. If we’re already growing it in cow milk, and we’re already drinking cow milk, is it really that much of a stretch to combine the two in a nice, refreshing, frothy cup?</p>
<p>Or baby bottle?</p>
<p>Dr. Li and his research team hopes that their readily available “humanized” milk will provide an option for women who  can’t breast feed or don’t want to breast feed their child. Unfortunately it seems that fear-mongering, anti-GM groups often cause the benefits of GM to get overlooked, this despite the majority of American citizens eating GM foods <a href="http://singularityhub.com/2009/07/15/the-genetically-modified-food-you-eat/" target="_blank">without even realizing it</a>. My guess is that when GM foods bear fruit that is both more plentiful and more resilient, sticking with non-GM foods will become an increasingly pricey proposition. The EU is finding this out right now. Will they relax their restrictions on GM, or will China be left to move easily forward into this as-yet unexploited market?</p>
<p>[image credits: supercoolbaby.com, Maksim via wikicommons]</p>
<p>image 1: <a href="http://www.supercoolbaby.com/pictures/cowbottle.jpg" target="_blank">supercoolbaby</a><br />
image 2: <a href="http://upload.wikimedia.org/wikipedia/commons/7/77/Holstein_cows_large.jpg" target="_blank">wikicommons</a></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/01/12/cows-pave-the-way-for-profits-dangers-from-genetic-testing/" rel="bookmark"><img width="200" height="147" src="http://singularityhub.com/wp-content/uploads/2010/01/cow-genetic-testing.jpg" class="crp_thumb wp-post-image" alt="Cows Pave the Way for Profits (Dangers?) from Genetic Testing" title="Cows Pave the Way for Profits (Dangers?) from Genetic Testing" border="0" /></a> <a href="http://singularityhub.com/2010/01/12/cows-pave-the-way-for-profits-dangers-from-genetic-testing/" rel="bookmark" class="crp_title">Cows Pave the Way for Profits (Dangers?) from Genetic Testing</a></li><li><a href="http://singularityhub.com/2010/11/16/dairy-farms-go-robotic-cows-have-never-been-happier-video/" rel="bookmark"><img width="200" height="147" src="http://singularityhub.com/wp-content/uploads/2010/11/robotic-dairy-farm.jpg" class="crp_thumb wp-post-image" alt="Dairy Farms Go Robotic, Cows Have Never Been Happier (video)" title="Dairy Farms Go Robotic, Cows Have Never Been Happier (video)" border="0" /></a> <a href="http://singularityhub.com/2010/11/16/dairy-farms-go-robotic-cows-have-never-been-happier-video/" rel="bookmark" class="crp_title">Dairy Farms Go Robotic, Cows Have Never Been Happier (video)</a></li><li><a href="http://singularityhub.com/2010/12/09/robotic-butcher-award-winning-bot-de-bones-meat-like-a-pro-video/" rel="bookmark"><img width="200" height="152" src="http://singularityhub.com/wp-content/uploads/2010/12/HADMAS-R-robot-knife.jpg" class="crp_thumb wp-post-image" alt="Robot With Knife Can Carve Any Soft Tissue &#8211; Gulp! (video)" title="Robot With Knife Can Carve Any Soft Tissue &#8211; Gulp! (video)" border="0" /></a> <a href="http://singularityhub.com/2010/12/09/robotic-butcher-award-winning-bot-de-bones-meat-like-a-pro-video/" rel="bookmark" class="crp_title">Robot With Knife Can Carve Any Soft Tissue &#8211; Gulp! (video)</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2011/04/20/chinese-scientists-clone-cows-with-humanized-milk/feed/</wfw:commentRss>
		<slash:comments>2</slash:comments>
		</item>
		<item>
		<title>Cutting Edge Gene Therapy Successfully Treats Parkinson&#8217;s Symptoms</title>
		<link>http://singularityhub.com/2011/04/13/cutting-edge-gene-therapy-successfully-treats-parkinsons-symptoms/</link>
		<comments>http://singularityhub.com/2011/04/13/cutting-edge-gene-therapy-successfully-treats-parkinsons-symptoms/#comments</comments>
		<pubDate>Wed, 13 Apr 2011 14:56:38 +0000</pubDate>
		<dc:creator>Peter Murray</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[brain]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[genes]]></category>
		<category><![CDATA[medicine]]></category>
		<category><![CDATA[regenerative medicine]]></category>

		<guid isPermaLink="false">http://singularitytees.com/?p=30678</guid>
		<description><![CDATA[Imagine that for years you’ve lived with a body that is in constant, uncontrollable, motion: your hands tremble, your head [...]]]></description>
			<content:encoded><![CDATA[<div id="attachment_29738" class="wp-caption alignleft" style="width: 310px"><a href="http://singularityhub.com/wp-content/uploads/2011/03/CH02-2_InfusionPic_spot1.jpeg"><img class="size-full wp-image-29738" src="http://singularityhub.com/wp-content/uploads/2011/03/CH02-2_InfusionPic_spot1.jpeg" alt="" width="300" height="250" /></a><p class="wp-caption-text">Dr. Michael G. Kaplitt, co-founder of Neurologix, helped design the study in which the GAD gene was infused directly into the brains of Parkinson&#39;s disease patients.</p></div>
<p>Imagine that for years you’ve lived with a body that is in constant, uncontrollable, motion: your hands tremble, your head bobs, you walk in short, shuffling steps, and muscles all over your body spasm so strongly it’s painful. Everyday activities, like going to the bathroom, are incredibly difficult and time consuming. You may look at others who walk, talk, and go to the bathroom with an ease that is impossible for you to imagine and think, that’s “them,” not me.</p>
<p>This description is close to what life is like for many of the estimated<a href="http://www.pdf.org/en/parkinson_statistics" target="_blank"> 7 to 10 million people worldwide who have Parkinson’s disease</a>. But a <a href="http://www.thelancet.com/journals/laneur/article/PIIS1474-4422(11)70039-4/abstract" target="_blank">recent study</a> may offer hope that a change for the better could very well arrive in their near future. <a href="http://www.neurologix.net/" target="_blank">Neurologix, Inc.</a>, a biotech company based in Fort Lee, New Jersey, successfully used cutting edge gene therapy to improve <a href="http://www.ninds.nih.gov/disorders/parkinsons_disease/parkinsons_disease.htm" target="_blank">tremors, rigidity and other motor control problems</a> in a group of Parkinson’s disease patients, and with minimal side effects. If the therapy makes it to the market, it will be the first of its kind to do so.</p>
<p>For the uninitiated, gene therapy is a procedure in which a group of cells within the body are upgraded with one or more new genes to modify their behavior. The targeted cells are literally reprogrammed to exhibit new behaviors and abilities. A modified virus, called a vector, is used to safely infiltrate the targeted cells and inject them with the new genes. The viruses are mutated in a way to prevent their replicating out of control or causing any harm to the patient.</p>
<p>In the treatment being tested by Neurologix, gene therapy is used to modify neurons within the <a href="http://www.wemove.org/par/par_subn.html" target="_blank">substantia nigra</a>, an area in the back of the brain responsible for motor control. The gene therapy is aimed at increasing the expression of the GAD gene within the targeted neurons. GAD is used within neurons to make <a href="http://en.wikipedia.org/wiki/Gamma-Aminobutyric_acid" target="_blank">GABA</a>, an inhibitory <a href="http://en.wikipedia.org/wiki/Neurotransmitter" target="_blank">neurotransmitter</a> which is decreased in the Parkinsonian substantia nigra, resulting in overactive neuron firing. In theory, with increased GAD production, GABA production will also increase, putting a &#8220;break&#8221; on the overactive neurons in Parkinson&#8217;s patients.</p>
<p>Injecting a virus into a specific part of the brain is no small feat. To inject the GAD gene, the experimental half of the patients (22) had, under local anesthesia, holes drilled into their skulls into which catheters were inserted. They then went to a recovery room where the GAD gene was injected into the catheter. The remaining control patients (23) underwent sham &#8220;surgeries&#8221; in which researchers imitated the sounds of the procedure and pretended to drill a hole in the skull and insert a catheter. Six months following surgery, the motor skills of both patient groups were assessed. The placebo group showed an improvement of 11 percent. The group that received GAD improved their motor scores by 23 percent with all but two showing improvement.</p>
<p>The current study was the second trial that Neurologix has subjected their GAD gene therapy to. <a href="http://www.neurologix.net/products/parkinsons.html" target="_blank">Phase 1 took place in 2007</a> and included 22 patients. The study showed similar improvements but did not include a control group. Now that the therapy has passed phase 2 Neurologix is trying to raise the $30 to $40 million it will cost to conduct a phase 3 trial which requires 1,000 to 3,000 test subjects. After phase 3 is completed it is then up to the FDA to decide whether or not the therapy is safe enough to be sold.</p>
<p>The millions of people across the world with Parkinson&#8217;s disease and their families will be watching closely.</p>
<div id="attachment_29737" class="wp-caption alignleft" style="width: 310px"><a href="http://singularityhub.com/wp-content/uploads/2011/03/Brain1.jpeg"><img class="size-full wp-image-29737" src="http://singularityhub.com/wp-content/uploads/2011/03/Brain1.jpeg" alt="" width="300" height="174" /></a><p class="wp-caption-text">Neurons in the substantia nigra become impaired or die in people with Parkinson&#39;s disease. A new gene therapy, aimed at returning function to substantia nigra neurons, shows promising results.</p></div>
<p>If it does make it to market, Neurologix’s GAD gene will be a significant advancement in the treatment of Parkinson’s disease. At present the best treatment for Parkinson’s disease is <a href="http://www.parkinson.org/Parkinson-s-Disease/Treatment/Medications-for-Motor-Symptoms-of-PD/Carbidopa-levodopa" target="_blank">levodopa</a>. You might recall levodopa—also called L-dopa—bringing comatose patients to life in the movie “Awakenings” based on the book by Oliver Sacks. Like the GAD gene therapy, giving patients levodopa does not help prevent or reverse the actual disease but improves quality of life by alleviating symptoms. Unfortunately, as we saw in &#8220;Awakenings,&#8221; levodopa must be taken continually and its effectiveness typically wears off over time.</p>
<p><strong>The Promise of Gene Therapy</strong></p>
<p>To give cells back that which they have lost—as in returning Parkinsonian substantia nigra neurons to normal levels of dopamine or GABA production—is the ultimate hope in gene therapy. You permanently correct the cell itself rather than continually feeding it what it lacks. Making gene therapy ever more attractive is our increasing ability to identify the abnormal genes associated with inherited disease like Alzheimer’s disease, manic-depression, intestinal cancer, heart disease, diabetes, and many others.</p>
<p>But the road for gene therapy has been a rocky one. A four-year old girl with a severe combined immunodeficiency (SCID)—known to most as &#8220;bubble boy disease&#8221; from the famous story of David Vetter who was forced to live in a sterile bubble—became the first person to receive gene therapy in 1990. She got better, but whether or not it was due to the therapy or something else has since been a matter of debate. Much effort since then has been aimed at developing safe and effective gene therapies, but the fact is no gene therapy has yet been approved by the FDA.</p>
<p>Gene therapy is further complicated by the fact that diseases are, well, complicated. The advances in genetics that so enticingly <a href="http://singularityhub.com/2009/11/23/genome-study-reveals-new-links-to-parkinsons/" target="_blank">point us to potential targets for gene therapy</a> also reveal that many common disorders such as arthritis, diabetes, Alzheimer’s disease, and heart disease are brought on by the combined effects of multiple genes.</p>
<p>But a string of successes in the past few years clearly shows that gene therapy is marching forward:  in 2008, <a href="http://singularityhub.com/2009/01/09/vision-restored-to-blind-patients-in-gene-therapy-breakthrough/" target="_blank">vision was restored to patients with blindness brought on by a defective gene</a>; in 2009, 8 of 10 patients were <a href="http://singularityhub.com/2009/02/09/gene-therapy-cures-fatal-bubble-boy-disease/" target="_blank">cured of a form of bubble boy disease</a>; in 2010, a <a href="http://singularityhub.com/2010/09/23/man-with-blood-disease-free-from-life-of-transfusions-thanks-to-gene-therapy/" target="_blank">man was cured of a kind of blood disease called beta-thalassaemia</a>. Each of these success stories were the result of targeting single genes. The wait may be longer for gene therapies to tackle the more complicated, multi-gene diseases, but its evident that some diseases are amenable to a single gene approach. I think we can expect exciting results in the near future. Research is currently underway to develop gene therapies for <a href="http://www.ornl.gov/sci/techresources/Human_Genome/medicine/genetherapy.shtml#recent" target="_blank">Huntington&#8217;s disease, blood disorders, various forms of cancer, Sickle cell anemia, cystic fibrosis and deafness</a>.</p>
<p>To be clear, both the GAD gene and levodopa treat the symptoms, not the underlying causes of Parkinson&#8217;s disease. Until we know exactly why the neurons of the substantia nigra become impaired we won&#8217;t be able to develop a cure. For now we’ll have to be okay with that. And if Neurologix one day soon delivers a gene that improves quality of life for millions of the world’s people with Parkinson’s disease, I think they’ll be okay with that too.</p>
<p>[image credits: wearingoff.org, New York Presbyterian/Weill Cornell Medical College via The Dana Foundation]</p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/09/23/man-with-blood-disease-free-from-life-of-transfusions-thanks-to-gene-therapy/" rel="bookmark"><img width="200" height="148" src="http://singularityhub.com/wp-content/uploads/2010/09/gene-therapy-beta-thalassaemia.jpg" class="crp_thumb wp-post-image" alt="Gene Therapy Looks To Have Cured Man With Blood Disease" title="Gene Therapy Looks To Have Cured Man With Blood Disease" border="0" /></a> <a href="http://singularityhub.com/2010/09/23/man-with-blood-disease-free-from-life-of-transfusions-thanks-to-gene-therapy/" rel="bookmark" class="crp_title">Gene Therapy Looks To Have Cured Man With Blood Disease</a></li><li><a href="http://singularityhub.com/2009/02/09/gene-therapy-cures-fatal-bubble-boy-disease/" rel="bookmark"><img width="200" height="145" src="http://singularityhub.com/wp-content/uploads/2009/02/bubble-boy-disease-gene-therapy.jpg" class="crp_thumb wp-post-image" alt="Gene Therapy Cures Fatal Bubble Boy Disease" title="Gene Therapy Cures Fatal Bubble Boy Disease" border="0" /></a> <a href="http://singularityhub.com/2009/02/09/gene-therapy-cures-fatal-bubble-boy-disease/" rel="bookmark" class="crp_title">Gene Therapy Cures Fatal Bubble Boy Disease</a></li><li><a href="http://singularityhub.com/2009/01/09/vision-restored-to-blind-patients-in-gene-therapy-breakthrough/" rel="bookmark"><img width="200" height="152" src="http://singularityhub.com/wp-content/uploads/2009/01/gene-therapy-eye-vision.jpg" class="crp_thumb wp-post-image" alt="Vision Restored to Blind Patients in Gene Therapy Breakthrough" title="Vision Restored to Blind Patients in Gene Therapy Breakthrough" border="0" /></a> <a href="http://singularityhub.com/2009/01/09/vision-restored-to-blind-patients-in-gene-therapy-breakthrough/" rel="bookmark" class="crp_title">Vision Restored to Blind Patients in Gene Therapy Breakthrough</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2011/04/13/cutting-edge-gene-therapy-successfully-treats-parkinsons-symptoms/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
		</item>
		<item>
		<title>Complete Genomics Gears Up for IPO This Week</title>
		<link>http://singularityhub.com/2010/11/09/complete-genomics-gears-up-for-ipo-this-week/</link>
		<comments>http://singularityhub.com/2010/11/09/complete-genomics-gears-up-for-ipo-this-week/#comments</comments>
		<pubDate>Tue, 09 Nov 2010 17:40:50 +0000</pubDate>
		<dc:creator>Aaron Saenz</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[cliff reid]]></category>
		<category><![CDATA[complete genomics]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[genome]]></category>
		<category><![CDATA[human genome]]></category>
		<category><![CDATA[illumina]]></category>
		<category><![CDATA[Ion Torrent]]></category>
		<category><![CDATA[IPO]]></category>
		<category><![CDATA[pacific biosciences]]></category>
		<category><![CDATA[venture capital]]></category>
		<category><![CDATA[venture funds]]></category>
		<category><![CDATA[whole genome sequencing]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=22906</guid>
		<description><![CDATA[Open up your financial umbrellas, Complete Genomics is going to make it rain. The Mountain View startup has built a [...]]]></description>
			<content:encoded><![CDATA[<p><a href="http://singularityhub.com/wp-content/uploads/2010/11/complete-genomics-ipo.jpg"><img class="size-full wp-image-22907 alignleft" title="complete-genomics-ipo" src="http://singularityhub.com/wp-content/uploads/2010/11/complete-genomics-ipo.jpg" alt="complete-genomics-ipo" width="319" height="162" /></a></p>
<p>Open up your financial umbrellas,<a title="Complete Genomics" href="http://www.completegenomics.com/" target="_blank"> Complete Genomics</a> is going to make it rain. The Mountain View startup has built a name for itself as one of the premier providers of whole genome sequencing for humans. Now we are just days away from their IPO. <a title="SEC Complete Genomics IPO" href="http://www.sec.gov/Archives/edgar/data/1361103/000119312510236090/ds1a.htm" target="_blank">According to the filing statements with the SEC</a>, Complete Genomics will offer 6 million shares of their stock at a price between $12 to $14. To encourage prospective investors to leap at their offer, the company released details of its current and future production. At the beginning of the year, the worldwide total number of human genomes ever sequenced was less than 300. Complete Genomics produced that many in the third quarter of 2010 alone. They hope to produce 400 genomes per month by the end of the year. These are big numbers, and they&#8217;re likely to get bigger. Much much bigger. <a title="singularity-hub-complete-genomics-cliff-reid-interview" href="http://singularityhub.com/2010/01/26/exclusive-complete-genomics-to-sequence-1-million-genomes-interview-with-ceo/" target="_blank">In our interview with CEO Cliff Reid back in January</a>, he claimed that Complete Genomics would sequence 1 million human genomes by 2014, and at prices substantially lower than any on the market today (possibly &lt; $1000). The race to establish whole genome sequencing supremacy is underway, and this IPO will be a sign of how much faith the public has that Complete Genomics can come out on top.<br />
<span id="more-22906"></span><br />
It&#8217;s been a big season for genome sequencing. Ion Torrent, a company developing CMOS based DNA sequencing technology was <a title="Life Technologies Press Release" href="http://www.lifetechnologies.com/news-gallery/press-releases/2010/life-techologies-aouces-agreemet-to-acquire-io-torret.html" target="_blank">purchased by Life Technologies for $375 million</a>. Critical parts of the CMOS approach to DNA were actually licensed to Ion Torrent earlier in the year by <a title="singularity-hub-dna-electronics" href="http://singularityhub.com/2009/09/30/dna-electronics-has-a-hand-held-genetic-testing-device-interview-with-ceo/" target="_blank">DNA Electronics, a UK company looking to develop handheld genetic scanners</a> that we&#8217;ve discussed before. <a title="Pacific Biosciences" href="http://www.pacificbiosciences.com/" target="_blank">Pacific Biosciences</a> (NASDAQ: <a title="Google Finance" href="http://www.google.com/finance?q=NASDAQ:PACB" target="_blank">PACB</a>), which has developed optics based DNA sequencing tech, had its <a title="PB IPO Press Release" href="http://www.pacificbiosciences.com/sites/default/files/press_release_assets/PacBio_PricingRelease_FINAL.pdf" target="_blank">IPO at the end of October</a> and raised around $200 million. BGI, China&#8217;s premier genome institute recently <a title="BGI press release - OpGen" href="http://www.genomics.cn/en/news_show.php?type=show&amp;id=588" target="_blank">announced it was teaming up with OpGen</a> to further their own optical approach to DNA sequencing. Everywhere you look, from the EU to California to Asia, forces and finances are gathering to see who will provide the next generation of genome testing and analysis.</p>
<p>This heightened activity in the field may be just what Complete Genomics needs to fuel their IPO. With Ion Torrent selling for $375 M and Pacific Biosciences raising $200 M at a similar share price (~$16), Complete Genomics gets a good idea of what it can raise. The $86 million it hopes to pull in through its stock offering will nearly double what it has gained through venture investments. <a title="Complete Genomics Press Release" href="http://www.completegenomics.com/news-events/press-releases/Complete-Genomics-Inc-Announces-Completion-of-39-Million--Series-E-Financing-and-Addresses-Illumina-Patent-Infringement-Lawsuit-101026744.html" target="_blank">Complete Genomics gathered $39 million in venture funding this August</a> putting it up to around $91 million in total. With another $86 M, Complete Genomics would have the funds to expand its new sequencing centers aggressively &#8211; a key requirement if they are to develop as quickly as Cliff Reid seems to be planning. Investors may look at Complete Genomics&#8217;s competitors recent financial gains, compare their tech to CG&#8217;s rapidly growing capabilities,and flock to the IPO.</p>
<p>Yet such investments are not without their concerns. Even while raising venture funds, Complete Genomics was fighting off <a title="Complete Genomics press release" href="http://www.completegenomics.com/news-events/press-releases/Complete-Genomics-Inc-Announces-Completion-of-39-Million--Series-E-Financing-and-Addresses-Illumina-Patent-Infringement-Lawsuit-101026744.html" target="_blank">patent infringement lawsuits</a> from <a title="Illumina" href="http://www.illumina.com/" target="_blank">Illumina </a>- perhaps their <a title="singularity-hub-complete-genomics-illumina-battle" href="http://singularityhub.com/2010/01/14/illumina-and-complete-genomics-competing-for-sequencing-dominance/" target="_blank">main rival in whole genome sequencing</a>. Genetic testing based on SNP (single nucleotide polymorphisms) has faced growing concerns over accuracy and relevance in the light of <a title="singularity-hub-23-and-me-errors" href="http://singularityhub.com/2010/06/09/genetic-testing-mix-up-at-23andme-another-blow-to-the-industry/" target="_blank">real and perceived errors</a>. The field of genetics, in general, has faced criticism for the <a title="singularity-hub-10-years-after-human-genome-project" href="http://singularityhub.com/2010/05/25/the-genome-project-is-10-years-old-where-is-the-health-care-revolution/" target="_blank">lack of real world benefit for patients in the ten years after the first human genome was sequenced</a>. Investors may see Complete Genomics&#8217; cheap whole genome sequencing, which provides phenomenonally more data than SNP tests, as the technology that will come to dominate genetics and reconfirm its importance in medicine. Or they may see the uncertainty in genetics as a great reason to avoid investing in the field altogether.</p>
<p>The same factors which make investments a risk make them very exciting to techno-optimists like myself. I can&#8217;t say for certain that Complete Genomics will be the undisputed leader in whole genome sequencing. There&#8217;s too much potential competition from Illumina, and the CMOS and optical approaches developed by others are too attractive looking, to call things in Cliff Reid&#8217;s favor at the moment. Still, I do think Complete Genomics has the right approach to sequencing: specialize in one field (human genomes) and use economy of scale to push towards ever cheaper and larger production. 400 genomes a month by 2011 is an amazing accomplishment, especially as the costs for materials for each genome may be as low as $1800. The only way Complete Genomics is going to lose is if some other company can beat that. Either way, scientific research and personal genomics will have won. Cheap and fast whole genome sequencing will provide us with huge amounts of new genetic data that we can use to understand illnesses, and provide better healthcare. When your genome costs less than $1000 to sequence, millions all over the world will be encouraged to get themselves tested and claim an informed ownership of their own genetic information. Win or Fail, Complete Genomics&#8217; IPO is another sign that the next DNA revolution is near.</p>
<p><em>[image credit: Complete Genomics]<br />
[sources:<a title="Complete Genomics" href="http://www.completegenomics.com/" target="_blank"> Complete Genomics</a>, <a title="SEC Complete Genomics IPO" href="http://www.sec.gov/Archives/edgar/data/1361103/000119312510236090/ds1a.htm" target="_blank">SEC</a>] </em></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/02/22/complete-genomics-secures-new-customers-500-orders-for-whole-genome-sequences/" rel="bookmark"><img width="200" height="142" src="http://singularityhub.com/wp-content/uploads/2010/02/complete-genomics-lab.jpg" class="crp_thumb wp-post-image" alt="Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences" title="Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences" border="0" /></a> <a href="http://singularityhub.com/2010/02/22/complete-genomics-secures-new-customers-500-orders-for-whole-genome-sequences/" rel="bookmark" class="crp_title">Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences</a></li><li><a href="http://singularityhub.com/2009/11/05/complete-genomics-and-isb-team-up-for-huge-whole-genome-study/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Complete Genomics and ISB Team Up for Huge Whole Genome Study" title="Complete Genomics and ISB Team Up for Huge Whole Genome Study" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/11/05/complete-genomics-and-isb-team-up-for-huge-whole-genome-study/" rel="bookmark" class="crp_title">Complete Genomics and ISB Team Up for Huge Whole Genome Study</a></li><li><a href="http://singularityhub.com/2009/08/28/get-your-entire-genome-from-complete-genomics-for-5000/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Get Your Entire Genome From Complete Genomics For $5000" title="Get Your Entire Genome From Complete Genomics For $5000" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/08/28/get-your-entire-genome-from-complete-genomics-for-5000/" rel="bookmark" class="crp_title">Get Your Entire Genome From Complete Genomics For $5000</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2010/11/09/complete-genomics-gears-up-for-ipo-this-week/feed/</wfw:commentRss>
		<slash:comments>2</slash:comments>
		</item>
		<item>
		<title>DNA Factory Plans to Open Within 6 Months</title>
		<link>http://singularityhub.com/2010/07/28/dna-factory-plans-to-open-within-6-months/</link>
		<comments>http://singularityhub.com/2010/07/28/dna-factory-plans-to-open-within-6-months/#comments</comments>
		<pubDate>Thu, 29 Jul 2010 01:45:58 +0000</pubDate>
		<dc:creator>Drew Halley</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[biobrick]]></category>
		<category><![CDATA[biofab]]></category>
		<category><![CDATA[biological parts]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[nsf]]></category>
		<category><![CDATA[synthetic biology]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=19737</guid>
		<description><![CDATA[Good news for all you aspiring Craig Venters out there. Before the end of the year, synthetic biologists will have [...]]]></description>
			<content:encoded><![CDATA[<p><a href="http://singularityhub.com/wp-content/uploads/2010/07/DNA_NIH.jpg"><img class="alignleft size-full wp-image-19740" src="http://singularityhub.com/wp-content/uploads/2010/07/DNA_NIH.jpg" alt="" width="280" height="280" /></a>Good news for all you aspiring Craig Venters out there.  Before the end of the year, synthetic biologists will have a stocked factory of DNA building blocks with which to remix microbe life forms – one that will provide standardized, reliable components for the most creative of life sciences.  Best of all?  It’s free.</p>
<p>As we <a href="http://singularityhub.com/2010/05/02/bio-fab-ready-to-distribute-building-blocks-of-synthetic-life/">previously reported</a>, the <a href="http://www.biofab.org/">International Open Facility Advancing Biotechnology (BIOFAB)</a> is a project to produce thousands of standardized genetic “parts” for researchers to use in the pioneering work of synthetic biology.  Started with a seed grant from the National Science Foundation (NSF), BIOFAB is the world’s very first biological <a href="http://en.wikipedia.org/wiki/Design-build">design-build</a> facility.  They will be providing bioparts to researchers gratis to speed along national research into new drugs, biofuels, chemicals, you name it – all the promising frontiers of synthetic biology.  And they should be open for business within 6 months.<span id="more-19737"></span></p>
<p>So what exactly is a synthetic biology “part”?  Good question – that was exactly the topic of the project’s first human practices report (found <a href="http://www.biofab.org/what-is-a-part">here</a>).  The short answer is that biological parts are small snippets of DNA with basic, well-understood functions (e.g. the production of a certain protein).  Building a microbe from scratch is no easy task, especially if you have to identify and characterize all of these building blocks yourself.  That’s exactly what synthetic biologists have been doing – it costs millions of dollars and takes years of legwork.</p>
<p><a href="http://en.wikipedia.org/wiki/Synthetic_biology">Synthetic biology</a> is an emerging field that combines biology and engineering to reconfigure DNA into desirable results, generally microorganisms that can be used to produce drugs, perform chemical reactions, or work as fuels.  But because the field is so new, there haven’t yet been standards set for what works and what doesn’t.  Characterizing these basic components (and providing them) will give a common engineering language for researchers working on very different problems.  It will also make potential progress faster and cheaper.</p>
<div id="attachment_19741" class="wp-caption alignright" style="width: 370px"><a href="http://singularityhub.com/wp-content/uploads/2010/07/endy_arkin_biofab1.jpg"><img class="size-full wp-image-19741 " src="http://singularityhub.com/wp-content/uploads/2010/07/endy_arkin_biofab1.jpg" alt="" width="360" height="243" /></a><p class="wp-caption-text">BIOFAB director Drew Endy (Stanford) and co-director Adam Arkin (UC Berkeley)</p></div>
<p>But researchers will still have their work cut out for them.  One of the most problematic issues for synthetic biology – and one that BIOFAB deals with regularly – is that DNA snippets are only “parts” in the context of some “whole.”  Genes work in complex networks, altering one another’s expression in interdependent ways; removed from the context of a larger genome, the function of any particular genetic strand changes.  This makes the issue of isolating concrete characteristics to each part a difficult task: it acts differently depending on the surrounding DNA.  It’s significant that this difficulty is precisely what has been a <a href="http://singularityhub.com/2010/05/25/the-genome-project-is-10-years-old-where-is-the-health-care-revolution/">major road block for post-Genome Project genetics</a> more generally.</p>
<p>So who sets the standards?  Consider it Biology 2.0.  Collaborative, open source efforts from many different labs have resulted in the emergence of what are called <a href="http://en.wikipedia.org/wiki/BioBrick">BioBrick</a> standard parts.  Many of these have been collected and housed at the <a href="http://partsregistry.org/Main_Page">Registry for Standard Biological Parts</a>, founded in 2003 at MIT (we ran <a href="http://singularityhub.com/2009/07/22/mit-is-organizing-new-genetic-parts/">a story on this</a> last year).  The director of BIOFAB, Drew Endy of Stanford, was instrumental in shaping BioBrick part standards – and now his team is building a factory to provide them to the research world.</p>
<p>BIOFAB was launched in January of this year, and is currently a small scale operation (they have about 10 staff members total).  The project is housed in a Lawrence Berkeley National Labs building in Emeryville, CA, and is a collaboration between researchers from UC Berkeley and Stanford (apparently despite the <a href="http://en.wikipedia.org/wiki/Big_Game_(American_football)">football rivalry</a>).  Perhaps a dubious award to some, BIOFAB was <a href="http://www.eastbayexpress.com/ebx/best-local-innovator/BestOf?oid=1922961">named “Best Local Innovator”</a> by the East Bay Express, a Bay Area paper which also recommends the taco truck near my house.  Suffice to say I trust their opinion.</p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/05/02/bio-fab-ready-to-distribute-building-blocks-of-synthetic-life/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Bio-Fab Ready to Distribute Building Blocks of Synthetic Life" title="Bio-Fab Ready to Distribute Building Blocks of Synthetic Life" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2010/05/02/bio-fab-ready-to-distribute-building-blocks-of-synthetic-life/" rel="bookmark" class="crp_title">Bio-Fab Ready to Distribute Building Blocks of Synthetic Life</a></li><li><a href="http://singularityhub.com/2009/07/22/mit-is-organizing-new-genetic-parts/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="MIT is Organizing New Genetic Parts" title="MIT is Organizing New Genetic Parts" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/07/22/mit-is-organizing-new-genetic-parts/" rel="bookmark" class="crp_title">MIT is Organizing New Genetic Parts</a></li><li><a href="http://singularityhub.com/2010/05/20/venter-creates-first-synthetic-self-replicating-bacteria-from-scratch/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Venter Creates First Synthetic Self-Replicating Bacteria from Scratch" title="Venter Creates First Synthetic Self-Replicating Bacteria from Scratch" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2010/05/20/venter-creates-first-synthetic-self-replicating-bacteria-from-scratch/" rel="bookmark" class="crp_title">Venter Creates First Synthetic Self-Replicating Bacteria from Scratch</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2010/07/28/dna-factory-plans-to-open-within-6-months/feed/</wfw:commentRss>
		<slash:comments>8</slash:comments>
		</item>
		<item>
		<title>Secret Messages Coded Into DNA Of Venter Synthetic Bacteria</title>
		<link>http://singularityhub.com/2010/05/24/venters-newest-synthetic-bacteria-has-secret-messages-coded-in-its-dna/</link>
		<comments>http://singularityhub.com/2010/05/24/venters-newest-synthetic-bacteria-has-secret-messages-coded-in-its-dna/#comments</comments>
		<pubDate>Tue, 25 May 2010 02:08:49 +0000</pubDate>
		<dc:creator>Aaron Saenz</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[base pair]]></category>
		<category><![CDATA[code]]></category>
		<category><![CDATA[Craig Venter]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[J. Craig Venter Institute]]></category>
		<category><![CDATA[JCVI]]></category>
		<category><![CDATA[M. mycoides JCVI syn1.0]]></category>
		<category><![CDATA[synthetic biology]]></category>
		<category><![CDATA[watermarks]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=16943</guid>
		<description><![CDATA[Researchers at the J Craig Venter Institute recently unveiled their first self-replicating synthetic bacteria (M. mycoides JCVI-syn1.0) whose DNA was [...]]]></description>
			<content:encoded><![CDATA[<div id="attachment_16944" class="wp-caption alignleft" style="width: 211px"><a href="http://singularityhub.com/wp-content/uploads/2010/05/venter-synthetic-bacteria-watermark-diagram.jpg"><img class="size-full wp-image-16944  " title="venter-synthetic-bacteria-watermark-diagram" src="http://singularityhub.com/wp-content/uploads/2010/05/venter-synthetic-bacteria-watermark-diagram.jpg" alt="venter-synthetic-bacteria-watermark-diagram" width="201" height="194" /></a><p class="wp-caption-text">Want to crack the code? The new synthetic bacteria has watermarks (WM1) encoded inside its DNA.</p></div>
<p><a title="Singularity-hub-venter-synthetic-first-bacteria" href="http://singularityhub.com/2010/05/20/venter-creates-first-synthetic-self-replicating-bacteria-from-scratch/" target="_blank">Researchers at the J Craig Venter Institute recently unveiled their first self-replicating synthetic bacteria</a> (<em>M. mycoides JCVI-syn1.0</em>)  whose DNA was &#8216;programmed&#8217; base pair by base pair. To verify that they had synthesized a new organism and not assembled the DNA from another natural bacteria, scientists encoded a series of &#8216;watermarks&#8217; into the genes of <em>M. mycoides JCVI-syn1.0</em>. There are four of these hidden messages: an explanation of the coding system used, a URL address for those who crack the code to go visit, a list of 46 authors and contributors, and a series of famous quotes. The presence of these watermarks verifies that  <em>M. mycoides JCVI-syn1.0</em> truly is synthetic and demonstrates the precision and power of JCVI&#8217;s new techniques in synthetic biology.</p>
<p><span id="more-16943"></span> Craig Venter mentioned these watermarks in his interview with the journal Science, which published the most recent work with <em>M. mycoides JCVI-syn1.0</em>. Watch from 7:20 to 9:20 to hear him describe the idea:<br />
<object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" width="480" height="385" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,40,0"><param name="allowFullScreen" value="true" /><param name="allowscriptaccess" value="always" /><param name="src" value="http://www.youtube.com/v/47rUrlzdK3k&amp;hl=en_US&amp;fs=1&amp;rel=0" /><param name="allowfullscreen" value="true" /><embed type="application/x-shockwave-flash" width="480" height="385" src="http://www.youtube.com/v/47rUrlzdK3k&amp;hl=en_US&amp;fs=1&amp;rel=0" allowscriptaccess="always" allowfullscreen="true"></embed></object></p>
<p>This isn&#8217;t the first time that JCVI has been marking its territory. Back in 2008 when they were still working on getting a bacteria genome assembled they used the four &#8216;letters&#8217; of DNA (G,A,T,C) to scribble a few words into its genetic code. These messages used codons, groups of three letters which code for amino acids, to stand for 20 letters of the alphabet. As such, some substitutions (like &#8216;v&#8217; for &#8216;u&#8217;) were necessary. The results were relatively simple but still pretty cool:</p>
<ul>
<li>CRAIGVENTER coded as:<br />
TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA</li>
<li>VENTERINSTITVTE coded as:<br />
TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTAACTAGCTAA</li>
<li>HAMSMITH coded as:<br />
TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA</li>
<li>CINDIANDCLYDE coded as:<br />
TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGCTAATGGGTC<br />
GATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATG</li>
<li>GLASSANDCLYDE coded as:<br />
TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA</li>
</ul>
<p>For the creation of <em>M. mycoides JCVIsyn1.0</em>, the J. Craig Venter Institute decided to produce much larger and more elaborate watermarks. Each of the four is more than one thousand base pairs long. Also, instead of coding for just 20 letters, the new system includes all letters and forms of punctuation for the English language. This makes it very unlikely that JCVI is using the codon system from 2008. Want to actually code the messages? Thankfully you won&#8217;t need to get a copy of  <em>M. mycoides JCVIsyn1.0</em> and sequence its DNA. In their <a title="Gibson et al, 2010, Science" href="http://www.sciencemag.org/cgi/content/abstract/science.1190719" target="_blank">publication in Science</a>, JCVI included a figure (<a title="supplements to Gibson et al, 2010 Science" href="http://www.sciencemag.org/cgi/data/science.1190719/DC1/1" target="_blank">S.1</a>) which lists the base pairs for each watermark. They have a diagram of the bacteria&#8217;s DNA (<a title="PDF of mycoides DNA" href="http://www.jcvi.org/cms/fileadmin/site/research/projects/first-self-replicating-bact-cell/handouts/image4-lettersize.pdf" target="_blank">here as PDF</a>) which may come in handy in case position in the genome has some bearing on the way the information is encoded. To make things even clearer, JCVI also released the quotes used in the fourth watermark. Here they are:</p>
<ul>
<li>&#8220;TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE.&#8221; &#8211; from James Joyce&#8217;s <a title="What is A Portrait of the Artist as a Young Man" href="http://en.wikipedia.org/wiki/A_Portrait_of_the_Artist_as_a_Young_Man" target="_blank">A Portrait of the Artist as a Young Man.</a></li>
<li>&#8220;SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE.”- a quote from the book, <a title="American Prometheus" href="http://www.americanprometheus.org/" target="_blank">American Prometheus</a> which discusses J. Robert Oppenheimer and the first atomic bomb.</li>
<li><strong>*</strong>&#8220;WHAT I CANNOT BUILD, I CANNOT UNDERSTAND.&#8221; &#8211; attributed to <a title="Who is Richard Feynman?" href="http://en.wikipedia.org/wiki/Richard_Feynman" target="_blank">Richard Feynman</a> (physicist, philosopher, badass) as the last words on his blackboard at the time of his death as described in <a title="Universe in a Nutshell" href="http://www.amazon.com/Universe-Nutshell-Stephen-William-Hawking/dp/055380202X" target="_blank">The Universe in a Nutshell</a> by Stephen Hawking (physicist, philosopher, badass).</li>
</ul>
<p><strong>*</strong><em>Most other sources list this quote as &#8220;What I cannot create, I cannot understand.&#8221;</em></p>
<div id="attachment_16948" class="wp-caption alignright" style="width: 313px"><a href="http://singularityhub.com/wp-content/uploads/2010/05/venter-synthetic-bacteria-watermarks.jpg"><img class="size-full wp-image-16948   " title="venter-synthetic-bacteria-watermarks" src="http://singularityhub.com/wp-content/uploads/2010/05/venter-synthetic-bacteria-watermarks.jpg" alt="venter-synthetic-bacteria-watermarks" width="303" height="206" /></a><p class="wp-caption-text">Full code for each 1000+ base pair watermark can be found in the related article in Science (figure S.1)</p></div>
<p>These watermarks do much more than function as the first brainteaser ever inscribed in an organism&#8217;s genetic code. As Venter described in the video, the watermarks serve the practical application of proving that the DNA coded in <em>M. mycoides JCVIsyn1.0</em> is the artificial genome that JCVI programmed (and that is mostly adopted from the natural <em>M. mycoides</em> bacteria). It also serves as an indication of intellectual property rights, so we may see such watermarks appearing in many new synthetic organisms in the future. Finally, being able to include these watermarks is proof of the incredible feats capable when you program an organism&#8217;s DNA base pair by base pair.</p>
<p>Just think of the precision required for this work. Each base pair has to be placed correctly to form the watermark. The watermark itself has to be &#8216;neutered&#8217; sandwiched by leading/trailing DNA sequences to make sure that the proteins encoded by the watermarks aren&#8217;t built by the cell&#8217;s mechanisms.</p>
<p>That precision has been put to other uses besides just writing messages. <em>M. mycoides</em> (the natural organism) is a mild pathogen found in goats. As Venter describes in the video (10:16), in the process of creating <em>M. mycoides JCVIsyn1.0</em>, the JCVI team deleted 14 of the genes it thinks are responsible for its toxicity in goats. They also insured that it has a dependence on a certain antibiotic and a need for a rich medium in the lab. These precautionary measures are used to insure that the synthetic bacteria is not only benign but also unable to escape, and such techniques are made possible through the same base pair precision used to code the watermarks. In the future the same procedure could be used to create &#8216;suicides genes&#8217; and complex chemical dependency in synthetic organisms to keep them safe and controllable.</p>
<p>I think its hard to describe the powerful positive potential that is provided by JCVI&#8217;s DNA programming approach to synthetic biology. Building an organism base pair by base pair is just extraordinary. It will undoubtedly take years before a profitable and beneficial organism can be created for widespread use, but I don&#8217;t think it&#8217;s an exaggeration to say that this technology has the capability to profoundly change the world for the better in the near future. Already Venter is discussing how the techniques used to assemble the <em>M. mycoides JCVIsyn1.0</em> DNA could be adapted to help create new vaccines rapidly and cheaply. We live in exciting times &#8211; the keys to life are in the hands of those who dare to use them.</p>
<p><em>[image credits: Gibson et al, Science 2010; JCVI]<br />
[video credit: Science]<br />
[source:<a title="Gibson et al, Science 2010" href="http://www.sciencemag.org/cgi/content/abstract/science.1190719"> Gibson et al, Science 2010</a>, <a title="JCVI press release" href="http://www.jcvi.org/cms/press/press-releases/full-text/article/first-self-replicating-synthetic-bacterial-cell-constructed-by-j-craig-venter-institute-researcher/" target="_blank">JCVI</a>, <a title="Telegraph on original watermarks 2008" href="http://www.telegraph.co.uk/science/science-news/3323937/Watermarks-written-in-first-artificial-genome.html" target="_blank">Telegraph.co.uk</a>]</em></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/05/20/venter-creates-first-synthetic-self-replicating-bacteria-from-scratch/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Venter Creates First Synthetic Self-Replicating Bacteria from Scratch" title="Venter Creates First Synthetic Self-Replicating Bacteria from Scratch" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2010/05/20/venter-creates-first-synthetic-self-replicating-bacteria-from-scratch/" rel="bookmark" class="crp_title">Venter Creates First Synthetic Self-Replicating Bacteria from Scratch</a></li><li><a href="http://singularityhub.com/2010/02/08/venters-successes-in-creating-synthetic-life-video/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Venter&#8217;s Successes in Creating Synthetic Life (video)" title="Venter&#8217;s Successes in Creating Synthetic Life (video)" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2010/02/08/venters-successes-in-creating-synthetic-life-video/" rel="bookmark" class="crp_title">Venter&#8217;s Successes in Creating Synthetic Life (video)</a></li><li><a href="http://singularityhub.com/2009/06/24/artificial-life-on-the-horizon/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Artificial Life on the Horizon" title="Artificial Life on the Horizon" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/06/24/artificial-life-on-the-horizon/" rel="bookmark" class="crp_title">Artificial Life on the Horizon</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2010/05/24/venters-newest-synthetic-bacteria-has-secret-messages-coded-in-its-dna/feed/</wfw:commentRss>
		<slash:comments>18</slash:comments>
		</item>
		<item>
		<title>Bio-Fab Ready to Distribute Building Blocks of Synthetic Life</title>
		<link>http://singularityhub.com/2010/05/02/bio-fab-ready-to-distribute-building-blocks-of-synthetic-life/</link>
		<comments>http://singularityhub.com/2010/05/02/bio-fab-ready-to-distribute-building-blocks-of-synthetic-life/#comments</comments>
		<pubDate>Sun, 02 May 2010 20:15:01 +0000</pubDate>
		<dc:creator>Christopher de la Torre</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[adam arkin]]></category>
		<category><![CDATA[biobrick]]></category>
		<category><![CDATA[biofab]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[drew endy]]></category>
		<category><![CDATA[gaymon bennett]]></category>
		<category><![CDATA[genetic engineering]]></category>
		<category><![CDATA[synthetic biology]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=15716</guid>
		<description><![CDATA[The first biological design-build facility in the world announced that it will soon be able to synthesize chemicals, fuels and [...]]]></description>
			<content:encoded><![CDATA[<p><a href="http://singularityhub.com/wp-content/uploads/2010/04/biofab-logo.png"><img class="alignleft size-full wp-image-15718" src="http://singularityhub.com/wp-content/uploads/2010/04/biofab-logo.png" alt="" width="209" height="104" /></a>The first biological design-build facility in the world announced that it will soon be able to synthesize chemicals, fuels and new drugs by manipulating the elements necessary to make microbes. Initiated by a grant from the National Science Foundation (NSF), the facility&#8217;s product—standardized biological parts made from genetic material—will be made available to both academic and commercial users, shortening development time and lowering research costs in the process.</p>
<p><span id="more-15716"></span>In its first human practices draft-for-comment report, <a href="http://www.biofab.org" target="_blank">The BioFab: International Open Facility Advancing Biotechnology (BIOFAB)</a> asked the core question of “what is a part?” in biology. The report explores the complexity, boundaries and evolution of biological engineering, and seeks to determine what standardization might mean for the industry.</p>
<p>One of BioFab&#8217;s projects—and they all seem quite ambitious—aims to build thousands of biological parts needed to control genetic expression in a select number of organisms. This collection—known as &#8220;C. dog.&#8221;—will make it possible to manipulate DNA/RNA/Protein synthesis in <em>E. coli </em>(a bacterium) and <em>S. cerevisiae</em> (a budding yeast). The product, to be used to aid researchers, will be released under the <a href="http://openwetware.org/wiki/The_BioBricks_Foundation:BPA" target="_blank">terms of a legal framework</a> that enables the free exchange and use of standard biological parts.</p>
<p>Founded at the end of 2009 by bioengineering assistant professor Drew Endy and UC Berkeley’s Adam Arkin, The professionally staffed public-benefit facility represents “the first significant focused investment in the development of open technology platforms underlying and supporting the next generation of biotechnology” (<a href="http://www.biofab.org" target="_blank">BioFab.org</a>). And with generous funding from the NSF and other prominent organizations, the operation will eventually be able to shell out tens of thousands of standard biological parts each year. While such a program reeks of ethical concerns, head of BioFab’s human practices Gaymon Bennett promises that <a href="http://med.stanford.edu/ism/2010/january/biofab-0125.html" target="_blank">ethical issues, including safety and security, will be addressed</a> by creating resources that will help researchers make tough decisions. The effort will also create a new  legal framework in support of its burgeoning technologies.</p>
<div id="attachment_15723" class="wp-caption alignright" style="width: 307px"><a href="http://singularityhub.com/wp-content/uploads/2010/04/biofab-012510.jpg"><img class="size-full wp-image-15723   " src="http://singularityhub.com/wp-content/uploads/2010/04/biofab-012510.jpg" alt="" width="297" height="238" /></a><p class="wp-caption-text">BioFab Directors Drew Endy (left) and Adam Arkin</p></div>
<p>Synthesizing biological parts from genes may have far-reaching ethical implications, but we can’t say it’s altogether a new idea. <a href="http://singularityhub.com/2010/04/21/is-it-ethical-to-genetically-sequence-kids-if-theres-no-immediate-health-concern/" target="_self">Designer babies</a> have long been a part of public debate, and recent advancements like <a href="../2009/07/22/mit-is-organizing-new-genetic-parts/" target="_self">MIT&#8217;s  registry of standard biological parts</a> have paved the way for initiatives like  BioFab. But there&#8217;s a big difference between making biological parts and figuring out how those parts will work together.</p>
<p>Creating functioning interchangeable biological parts is at the heart of BioFab’s mission. Taking modern synthetic biology’s mantra that a system is an integrated set of components one step further, BioFab will attempt to define, in context, what a component is, building on the assumption that standardized ‘parts’ don’t yet exist, and that such parts are made, not discovered.</p>
<p>It was clear from early on in biology’s synthetic saga that DNA’s unpredictable methods of assembly would make standardization a challenge, but several years into the new millennium a proposal was made as to how restriction enzymes could isolate <a href="http://en.wikipedia.org/wiki/BioBrick" target="_blank">DNA “BioBricks”</a> that could effectively “mix and match” with one another using complimentary strands of overhanging base pairs. While this provided a solution to putting engineered DNA components together, it couldn’t solve how to get them to work together in predictable ways. It turns out that sans context, standardized biological parts are little more than words of an indecipherable language.</p>
<p>Quantifying and categorizing genetic structures—both upon which genome sequencing is based—are not in themselves new goals. The present conundrum lies not in the ability to break things down into workable units, but rather in how to reverse the process and create anew using those units. Such is the driving force behind bioengineering, and now BioFab.</p>
<p><em>[Image credit: BIOFAB, Margot Hartford]</em><br />
<em>[Source: <a href="http://www.biofab.org" target="_blank">BIOFAB</a>, <a href="http://med.stanford.edu/ism/2010/january/biofab-0125.html" target="_blank">Stanford School of Medicine</a>]</em></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/07/28/dna-factory-plans-to-open-within-6-months/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="DNA Factory Plans to Open Within 6 Months" title="DNA Factory Plans to Open Within 6 Months" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2010/07/28/dna-factory-plans-to-open-within-6-months/" rel="bookmark" class="crp_title">DNA Factory Plans to Open Within 6 Months</a></li><li><a href="http://singularityhub.com/2009/11/17/andrew-hessels-singularity-university-talk-on-synthetic-biology-video/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Andrew Hessel&#8217;s Singularity University Talk on Synthetic Biology (Video)" title="Andrew Hessel&#8217;s Singularity University Talk on Synthetic Biology (Video)" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/11/17/andrew-hessels-singularity-university-talk-on-synthetic-biology-video/" rel="bookmark" class="crp_title">Andrew Hessel&#8217;s Singularity University Talk on Synthetic Biology (Video)</a></li><li><a href="http://singularityhub.com/2009/09/24/igem-2009-synthetic-biology-competition-bigger-than-ever-this-halloween/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="iGEM 2009: Synthetic Biology Competition Bigger than Ever this Halloween" title="iGEM 2009: Synthetic Biology Competition Bigger than Ever this Halloween" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/09/24/igem-2009-synthetic-biology-competition-bigger-than-ever-this-halloween/" rel="bookmark" class="crp_title">iGEM 2009: Synthetic Biology Competition Bigger than Ever this Halloween</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2010/05/02/bio-fab-ready-to-distribute-building-blocks-of-synthetic-life/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>US Court Strikes Down Patent on Human Genes &#8211; Huge News for Genomics</title>
		<link>http://singularityhub.com/2010/03/29/us-district-court-strikes-down-patent-on-human-genes-huge-news-for-genomics/</link>
		<comments>http://singularityhub.com/2010/03/29/us-district-court-strikes-down-patent-on-human-genes-huge-news-for-genomics/#comments</comments>
		<pubDate>Tue, 30 Mar 2010 01:41:31 +0000</pubDate>
		<dc:creator>Aaron Saenz</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[ACLU]]></category>
		<category><![CDATA[court]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[genetic rights]]></category>
		<category><![CDATA[genetically modified]]></category>
		<category><![CDATA[genomics]]></category>
		<category><![CDATA[intellectual property]]></category>
		<category><![CDATA[legal]]></category>
		<category><![CDATA[Myriad Genetics]]></category>
		<category><![CDATA[patents]]></category>
		<category><![CDATA[Robert Sweet]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=14301</guid>
		<description><![CDATA[In what is sure to become a landmark case for genomics, a US District Court Judge in New York (Robert [...]]]></description>
			<content:encoded><![CDATA[<div id="attachment_14308" class="wp-caption alignleft" style="width: 191px"><a href="http://singularityhub.com/wp-content/uploads/2010/03/court-case-strikes-down-gene-patent.jpg"><img class="size-full wp-image-14308" title="court-case-strikes-down-gene-patent" src="http://singularityhub.com/wp-content/uploads/2010/03/court-case-strikes-down-gene-patent.jpg" alt="court case strikes down gene patent" width="181" height="189" /></a><p class="wp-caption-text">US District Court ruled in favor of the ACLU against Myriad Genetics, striking down their patents on human genes.</p></div>
<p>In what is sure to become a landmark case for genomics, a US District Court Judge in New York (Robert Sweet) has ruled that patents on human genes held by <a title="Myriad Genetics" href="http://www.myriad.com/" target="_blank">Myriad Genetics</a> are invalid. These patents, on the BRCA1 and BRCA2 genes, were issued more than a decade ago and gave Myriad exclusive rights to examine those sections of DNA. Mutations in BRCA 1 and 2 carry important links to breast and ovarian cancer, and <a title="BRAC analysis" href="http://www.bracnow.com/" target="_blank">Myriad&#8217;s BRAC Analysis</a> (Be Ready Against Cancer) genetic screening is used to provide patients with a better understanding of their risk for the diseases. The court decision effectively eliminates Myriad&#8217;s rights to solely market tests on the BRCA genes, which may lower costs (previously up to $3000) for those interested in the tests . The American Civil Liberties Union (ACLU) lead the attack against the Myriad patents which it shares equally with the University of Utah Research Foundation. This case has wide ranging implications for the entire genomics community. 20% of human genes are patented, often along with the process of identifying the genes, and these patents are now drawn into question. It is almost certain that this ruling will be appealed and eventually reach the US Supreme Court. It may take years before a final decision is made, but for now it seems like the human genome may no longer be up for grabs as intellectual property. Thank goodness.</p>
<p><span id="more-14301"></span></p>
<p>Biotech intellectual property rights are big business.  We&#8217;ve seen <a title="singularity-hub-stem-cell-patent" href="http://singularityhub.com/2010/02/12/athersys-secures-stem-cell-patents-and-stock-swells/" target="_blank">company stock prices surge with the grant of a new patent</a>. Myriad&#8217;s price (<a title="MYGN prices" href="http://www.google.com/finance?q=NASDAQ:MYGN" target="_blank">NASDAQ: MYGN</a>) had a rough drop since the announcement of the court ruling. Investors, not just in Myriad but in all firms with genetic patents, must be asking themselves how far reaching this decision may be.</p>
<p>Judge Sweet&#8217;s ruling is long (150+ pages), but you can find a <a title="Court Ruling on Myriad Genetics Patents" href="http://www.genomicslawreport.com/wp-content/uploads/2010/03/Myriad-SJ-Opinion.pdf" target="_blank">copy of it here</a> thanks to the Genomics Law Report. Likewise, the patents Myriad holds on the BRCA genes are numerous (<a title="Myriad Genetics patent" href="http://www.google.com/patents/about?id=AOoYAAAAEBAJ&amp;dq=myriad+genetics+BRCA" target="_blank">1</a>,<a title="Myriad Genetics patent" href="http://www.google.com/patents/about?id=u-YZAAAAEBAJ&amp;dq=myriad+genetics+BRCA" target="_blank">2</a>,<a title="Myriad Genetics patent" href="http://www.google.com/patents/about?id=veYZAAAAEBAJ&amp;dq=myriad+genetics+BRCA" target="_blank">3</a>,<a title="Myriad Genetics patent" href="http://www.google.com/patents/about?id=ZFMWAAAAEBAJ&amp;dq=myriad+genetics+BRCA" target="_blank">4</a>, <a title="Myriad Genetics patent" href="http://www.google.com/patents?q=myriad+genetics+BRCA&amp;btnG=Search+Patents" target="_blank">&#8230;</a>). Trying to sift through this legal material is difficult, but we can summarize the ruling down to two facts. Sweet found that:</p>
<ol>
<li>The DNA patented by Myriad Genetics (isolated from the human body in a lab, along with mutations there of) are not markedly different from natural DNA (that found in your body, mutated or otherwise).</li>
<li>Comparing DNA sequences to identify BRCA genes and their mutations is an abstract mental process.</li>
</ol>
<p>In other words, you can&#8217;t patent nature and you can&#8217;t patent a fundamental idea of science. There&#8217;s little doubt that the breadth of these two findings are likely to apply to the vast majority of patents on genes in the United States.</p>
<p>Human genes, that is. Patents on plants and animals are unlikely to be called into question at this time. That&#8217;s because many such patents are not held on &#8216;natural&#8217; organisms, but on those that have been genetically modified. Whether it&#8217;s <a title="singularity-hub-genetically-modified-food" href="http://singularityhub.com/2010/01/26/genetically-modified-rice-and-corn-to-grow-in-china-then-the-world/" target="_blank">pest-resistant rice</a> or <a title="singularity-hub-artificial-meat" href="http://singularityhub.com/2009/12/09/artificial-meat-could-be-on-your-table-in-5-years/" target="_blank">artificial meat</a>, GM foods are generally thought to represent an engineered good.</p>
<div id="attachment_14311" class="wp-caption alignright" style="width: 257px"><a href="http://singularityhub.com/wp-content/uploads/2010/03/court-case-strikes-down-gene-patent-quote.jpg"><img class="size-full wp-image-14311" title="court-case-strikes-down-gene-patent-quote" src="http://singularityhub.com/wp-content/uploads/2010/03/court-case-strikes-down-gene-patent-quote.jpg" alt="quote" width="247" height="256" /></a><p class="wp-caption-text"> </p></div>
<p>Which begs the question, would Sweet&#8217;s ruling cover human genes that have undergone engineering. Probably not, but the germline mutations of humans is still largely opposed so the cases involved are likely to be small. One day, however, we may all carry a few genetic modifications. Gene therapies could alter the DNA (or maybe just the protein production) in our bodies. Would such variations then mean we are carrying some corporation&#8217;s intellectual property inside us? What if someone naturally developed such genes on their own&#8230;would their bodies be committing copyright infringement?</p>
<p>That&#8217;s the sort of terrifying prospect that could await us if we continue to allow patents on human genetic material. It&#8217;s one thing to patent a process on making a chemical, or even that chemical itself, but when the chemical is your DNA&#8230;your allowing ownership (at least in part) of a human.</p>
<p>Of course Myriad Genetics isn&#8217;t trying to enslave humanity. No biopharmaceutical company, as far I can tell, is so stupidly nefarious. MG&#8217;s products help patients identify their risks of cancer. That&#8217;s certainly not a bad thing &#8211; in fact it should be applauded. Indeed, Myriad Genetics has made the claim that such patents on genes allow the holding company to develop techniques secure in the knowledge that they can turn a profit to compensate for their investment. Without such guarantees to their work, MG lawyers have argued, research will be stifled.</p>
<p>But certainly research has been stifled in the other direction as well. By holding exclusive rights to the BRCA genes, Myriad Genetics keeps other companies from freely working on the same gene without fear of legal reprisal.  Apply that scenario to the 20% of human genes patented and you begin to wonder how much research has been stunted by this hording of genetic territory. If we applaud MG for developing cancer risk assessments and treatments, we must also reprimand them for preventing others from doing the same.</p>
<p>We may need to rethink patents. Intellectual property as a whole is undergoing a metamorphosis (much like privacy) and it&#8217;s becoming increasingly clear that such restrictions may not be enforceable. China seems to violate patents whenever it feels like it. Brazil permitted the creation of generic versions of AIDS medications in spite of patents. Even within a single country (like the US) consumers are pirating copyrighted material. We are struggling with these legal issues (locally and globally) but it seems likely that the free exchange of information (via the internet) is counteracting the premise of intellectual property on a fundamental level.</p>
<p>Even if we somehow managed to find ways to rigidly enforce all patents, I don&#8217;t think we would want to extend that enforcement into genetics. We are our genes. Even as we learn to alter and influence how those genes are expressed, humans still need the inalienable rights to their DNA. Anything else would be socially disruptive on a grand scale, not to mention terrifying. In the more limited cases of research and development (patenting just the identification process or a certain technique to refine genetic material for testing) things may become gray. How can we best allow companies to find a return on their investment (and thus encourage investment) without preventing other firms from also developing similar work (thus encouraging research)? It&#8217;s a difficult question and one that is likely to be years in the answering. For now, it is enough to look at Judge Sweet&#8217;s ruling and wonder how long it will be until the next court case. We&#8217;ve only just begun.</p>
<p><em>[image credit:ACLU]<br />
[Source: <a title="Court Ruling on Myriad Genetics Patents" href="http://www.genomicslawreport.com/wp-content/uploads/2010/03/Myriad-SJ-Opinion.pdf" target="_blank">US District Court Ruling</a>, <a title="Genomics Law Report" href="http://www.genomicslawreport.com/index.php/tag/aclumyriad-litigation/" target="_blank">Genomics Law Report</a>, <a title="Myriad Genetics" href="http://www.myriad.com/" target="_blank">Myriad Genetics</a>]</em></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/08/11/who-owns-you-20-of-the-genes-in-your-body-are-patented-video/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Who Owns You?  20% of the Genes in Your Body are Patented" title="Who Owns You?  20% of the Genes in Your Body are Patented" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2010/08/11/who-owns-you-20-of-the-genes-in-your-body-are-patented-video/" rel="bookmark" class="crp_title">Who Owns You?  20% of the Genes in Your Body are Patented</a></li><li><a href="http://singularityhub.com/2010/04/10/boolean-logic-unlocks-the-key-to-finding-new-genes-in-milliseconds/" rel="bookmark"><img width="200" height="145" src="http://singularityhub.com/wp-content/uploads/2010/04/boolean-logic-genes.jpg" class="crp_thumb wp-post-image" alt="Boolean Logic Unlocks The Key To Finding New Genes in Milliseconds" title="Boolean Logic Unlocks The Key To Finding New Genes in Milliseconds" border="0" /></a> <a href="http://singularityhub.com/2010/04/10/boolean-logic-unlocks-the-key-to-finding-new-genes-in-milliseconds/" rel="bookmark" class="crp_title">Boolean Logic Unlocks The Key To Finding New Genes in Milliseconds</a></li><li><a href="http://singularityhub.com/2010/02/12/athersys-secures-stem-cell-patents-and-stock-swells/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Athersys Secures Stem Cell Patents and Stock Swells" title="Athersys Secures Stem Cell Patents and Stock Swells" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2010/02/12/athersys-secures-stem-cell-patents-and-stock-swells/" rel="bookmark" class="crp_title">Athersys Secures Stem Cell Patents and Stock Swells</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2010/03/29/us-district-court-strikes-down-patent-on-human-genes-huge-news-for-genomics/feed/</wfw:commentRss>
		<slash:comments>16</slash:comments>
		</item>
		<item>
		<title>Yale Scientists Diagnose Illness Through Genome Sequencing</title>
		<link>http://singularityhub.com/2009/10/27/first-case-of-diagnosis-by-whole-genome-sequencing/</link>
		<comments>http://singularityhub.com/2009/10/27/first-case-of-diagnosis-by-whole-genome-sequencing/#comments</comments>
		<pubDate>Tue, 27 Oct 2009 14:46:54 +0000</pubDate>
		<dc:creator>Aaron Saenz</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[Longevity And Health]]></category>
		<category><![CDATA[bartter's syndrome]]></category>
		<category><![CDATA[diagnosis]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[richard lifton]]></category>
		<category><![CDATA[whole genome sequencing]]></category>
		<category><![CDATA[yale]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=8687</guid>
		<description><![CDATA[A doctor has some tried and true methods of helping her diagnose a disease: examining the lymph nodes, taking your [...]]]></description>
			<content:encoded><![CDATA[<div id="attachment_8688" class="wp-caption alignleft" style="width: 310px"><img class="size-medium wp-image-8688  " title="whole-genome-sequencing-diagnosis" src="http://singularityhub.com/wp-content/uploads/2009/10/whole-genome-sequencing-diagnosis-300x240.jpg" alt="For the first time, researchers at Yale have used whole genome sequencing to make a clinical diagnosis." width="300" height="240" /><p class="wp-caption-text">For the first time, researchers at Yale have used whole genome sequencing to make a clinical diagnosis.</p></div>
<p>A doctor has some tried and true methods of helping her diagnose a disease: examining the lymph nodes, taking your temperature, that whole &#8220;turn your head and cough&#8221; thing. Now, we need to add one more: whole genome sequencing. Researchers at Yale have sequenced the genome of a patient in order to diagnose his condition, reportedly for the first time. <a title="richard lifton yale" href="http://www.med.yale.edu/genetics/fac/RichardLifton.php" target="_blank">Richard Lifton</a> and his team examined the protein encoding portion of an infant&#8217;s DNA to determine whether or not he had <a title="bartter's syndrome wikipedia" href="http://en.wikipedia.org/wiki/Bartter_syndrome" target="_blank">Bartter&#8217;s syndrome</a> (he didn&#8217;t).  Though still too expensive to use in everyday clinical work, Lifton has shown that whole genome analysis is an effective and relatively quick method to diagnose some diseases. We&#8217;re going to be seeing a lot more of this.</p>
<p>The costs of whole genome sequencing has been falling since the completion of the Human Genome Project. Industry leaders <a title="singularity-hub-complete-genomics" href="http://singularityhub.com/2009/09/09/complete-genomics-press-release-nearly-doubled-the-number-of-sequenced-human-genomes-since-march/" target="_blank">Complete Genomics</a> and <a title="singularity-hub-illumina" href="http://singularityhub.com/2009/09/14/illuminas-personalized-genome-sequencing-service-gets-first-customers/" target="_blank">Illumina</a> are pushing prices below $50,000 per genome and we could see it drop to $1000 within the next year.  Cheap genome sequencing will open up new avenues of diagnosis, but could also allow individuals greater insight into which diseases they should be on the lookout for. <a title="singularity-hub-IBM-genome-sequencing" href="http://singularityhub.com/2009/10/13/ibm-hypes-dna-transistor-sequencing-genomes-for-less-than-1000/" target="_blank">IBM announced that it will use silicon chip technology to speed up whole genome sequencing</a>, and we&#8217;ve already seen a <a title="singularity-hub-handheld-DNA" href="http://singularityhub.com/2009/09/30/dna-electronics-has-a-hand-held-genetic-testing-device-interview-with-ceo/" target="_blank">handheld device that finds special gene variations using CMOS components</a>. As genetic analysis gets faster and cheaper, the medical system will have to adjust to take advantage of the new information, hopefully with amazing results.</p>
<p><span id="more-8687"></span></p>
<p>Lifton&#8217;s analysis of the five month old infant&#8217;s genome came at the request of a Turkish doctor who feared the child&#8217;s dehydration and lack of weight gain was due to Bartter&#8217;s which often leads to fatal kidney disease. In just ten days, the Yale team was able to determine that the baby actually had a mutation in a gene that caused intestinal problems due to congenital chloride diarrhea. Not only that, but they discovered that  five other cases referred to them for Bartter&#8217;s were due to similar genetic mutation.</p>
<p>While the sequencing used in these tests spanned the entire genome of the patients, only the portions corresponding to protein coding were examined. The protein coding portion of the genome, called the exome, is just 1% of your DNA but 85% of all clinically important mutations occur there. Focusing on the exome allowed Lifton&#8217;s team to cut associated costs to one-tenth of what they would be if every gene had to be examined. Price reductions like this could allow genetic analysis to become a common tool in clinical diagnose much sooner than it would otherwise.</p>
<p>So here we have two exciting trends that could improve healthcare: dropping costs in whole genome sequencing, and finding ways to cut prices further by focusing on specific genes. These trends are likely to work in your favor: the genetic analysis that may warn you of high risks of cancer, heart disease, etc could become commonplace in your doctor&#8217;s office in the next five to ten years rather than in the next twenty five. While some worry about the lack of privacy, or the institutional prejudice, that could arise from easily sequencing someone&#8217;s DNA, I tend to focus on the better medical care that&#8217;s almost certain to arise. The more you know about how your body works, the more you can do to keep it healthy.</p>
<p><em>[photo credit: Yale University]</em></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2009/11/05/complete-genomics-and-isb-team-up-for-huge-whole-genome-study/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Complete Genomics and ISB Team Up for Huge Whole Genome Study" title="Complete Genomics and ISB Team Up for Huge Whole Genome Study" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/11/05/complete-genomics-and-isb-team-up-for-huge-whole-genome-study/" rel="bookmark" class="crp_title">Complete Genomics and ISB Team Up for Huge Whole Genome Study</a></li><li><a href="http://singularityhub.com/2010/02/22/complete-genomics-secures-new-customers-500-orders-for-whole-genome-sequences/" rel="bookmark"><img width="200" height="142" src="http://singularityhub.com/wp-content/uploads/2010/02/complete-genomics-lab.jpg" class="crp_thumb wp-post-image" alt="Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences" title="Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences" border="0" /></a> <a href="http://singularityhub.com/2010/02/22/complete-genomics-secures-new-customers-500-orders-for-whole-genome-sequences/" rel="bookmark" class="crp_title">Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences</a></li><li><a href="http://singularityhub.com/2009/08/28/get-your-entire-genome-from-complete-genomics-for-5000/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Get Your Entire Genome From Complete Genomics For $5000" title="Get Your Entire Genome From Complete Genomics For $5000" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/08/28/get-your-entire-genome-from-complete-genomics-for-5000/" rel="bookmark" class="crp_title">Get Your Entire Genome From Complete Genomics For $5000</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2009/10/27/first-case-of-diagnosis-by-whole-genome-sequencing/feed/</wfw:commentRss>
		<slash:comments>6</slash:comments>
		</item>
		<item>
		<title>DNA Electronics Has a Hand Held Genetic Testing Device &#8211; Interview with CEO!</title>
		<link>http://singularityhub.com/2009/09/30/dna-electronics-has-a-hand-held-genetic-testing-device-interview-with-ceo/</link>
		<comments>http://singularityhub.com/2009/09/30/dna-electronics-has-a-hand-held-genetic-testing-device-interview-with-ceo/#comments</comments>
		<pubDate>Wed, 30 Sep 2009 16:28:47 +0000</pubDate>
		<dc:creator>Aaron Saenz</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[Longevity And Health]]></category>
		<category><![CDATA[Chris Toumazou]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[DNA electronics]]></category>
		<category><![CDATA[genetic testing]]></category>
		<category><![CDATA[hand held device]]></category>
		<category><![CDATA[Leila Shepherd]]></category>
		<category><![CDATA[snp]]></category>
		<category><![CDATA[SNP chip]]></category>
		<category><![CDATA[SNP Dr.]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=7597</guid>
		<description><![CDATA[If your computer and your DNA had a baby, it would be the SNP Dr. from DNA Electronics. SNP Dr. [...]]]></description>
			<content:encoded><![CDATA[<div id="attachment_7598" class="wp-caption alignleft" style="width: 209px"><img class="size-medium wp-image-7598 " title="snp-dr-dna-electronics" src="http://singularityhub.com/wp-content/uploads/2009/09/snp-dr-dna-electronics-199x300.jpg" alt="The SNP Dr from DNA Electronics will allow you to find important genes in your DNA in less than 30 minutes." width="199" height="300" /><p class="wp-caption-text">DNA Electronics&#39; SNP Dr. will allow you to find important genes in your DNA in less than 30 minutes.</p></div>
<p>If your computer and your DNA had a baby, it would be the SNP Dr. from <a title="DNA-electronics" href="http://www.dnae.co.uk/company.htm" target="_blank">DNA Electronics</a>. SNP Dr. is the world&#8217;s first hand held semi-conductor device that will be able to read your DNA in about 15-30 minutes. I was able to chat with DNA Electronics CEO Prof. Chris Toumazou who is also the founder of <a title="singularity-hub-Toumaz-health-monitors" href="http://singularityhub.com/2009/07/13/sensor-sensibility-new-information-from-toumaz-ceo/" target="_blank">Toumaz Technologies, the company that brought you Sensium</a>. Toumazou let me in on how SNP Dr. will change medicine and genetic testing, and what we can look forward to in the future of semi-conductors and biology.</p>
<p>The current means of looking at your genetic code involves actual looking. Optic sensors help to pour through your DNA and discover variations. That technique is slow and difficult to scale down. Semiconductors, though, are getting faster and smaller every day. So a semiconductor device like SNP Dr. can be cheap and easily produced at a hand held size. Imagine a world where genetic testing could be done with just some spit, a cotton swab, and your iPhone.</p>
<p><span id="more-7597"></span></p>
<p>A single nucleotide polymorphism or SNP (pronounced &#8216;snip&#8217;) is an interesting single-gene variation in your DNA. Geneticists have discovered hundreds, many of which can indicate proclivities to disease, physical traits, or negative reactions to medicines. Companies like <a title="23andme-research-revolution" href="http://singularityhub.com/2009/08/17/23andme-leading-way-to-democratized-disease-research/" target="_blank">23andMe can test your DNA to see which SNPs you have</a>. The SNP Dr, still in early prototyping, has a semi-conductor processor (a &#8216;SNP chip&#8217;) that reads your DNA by looking for a SNP. Which SNP? Depends on what you need to do. Are you a doctor trying to make sure you can proscribe someone a medicine without it killing them? Soldier checking for biological weapons? Farmer trying to figure out which seeds you should plant to avoid parasitic infestation? DNA Electronics could develop a SNP chip for any of the above.</p>
<p><strong>Making semiconductors and biology play nice</strong></p>
<p>Prof. Toumazou&#8217;s background is in semiconductor design and engineering. He developed the ultra low power technology for IT applications that was adapted into medical sensing devices like Sensium. While working with a group trying to develop a cochlear implant, Toumazou started to realize that, &#8220;biology doesn&#8217;t need the higher precision of digital processing&#8230;The [modern] world is digital, but human space is analog.&#8221; Analog signals and processing mean lower power consumption and tinier devices.</p>
<p>But analog signals drift, which is problematic when you want to measure chemicals in body fluids like potassium, glucose, or urea (all one time projects of Toumazou). So what signal in your body doesn&#8217;t drift? The one that&#8217;s got all the important information anyway: your DNA.</p>
<p>With specialized molecules (polymerases) you can get reactions with DNA that release protons. That&#8217;s an electrical signal you can track with semiconductor technology. Get the right kind of reactions going, and you can detect all the changes in DNA. Find when base pairs switch and you can start reading your genetic code just by measuring changes in electrical signals. It&#8217;s like deciphering Morse Code when there is just four letters in the alphabet (GTCA). SNP Dr. represents one of the world&#8217;s first looks at combining DNA logic with CMOS technology.</p>
<p><strong>So can I buy one today?</strong></p>
<p>Semiconductor technology is well explored and well understood, so it&#8217;s no surprise that the semiconductor side of SNP Dr. is well underway. When the UK launched its <a title="UK-life-sciences-blueprint" href="http://www.dius.gov.uk/~/media/publications/O/ols-blueprint" target="_blank">Life Science Blueprint initiative</a> to strengthen government support of biotech in Britain, guess what they got to see at the labs of Imperial College? Check out the prototype version of SNP Dr in the video below (0:28). Yep, that&#8217;s Prime Minister Gordon Brown and Lord Drayson.<br />
<object width="486" height="412" data="http://c.brightcove.com/services/viewer/federated_f8/1570028817" type="application/x-shockwave-flash"><param name="name" value="flashObj" /><param name="bgcolor" value="#FFFFFF" /><param name="flashvars" value="videoId=29403988001&amp;playerId=1570028817&amp;viewerSecureGatewayURL=https://console.brightcove.com/services/amfgateway&amp;servicesURL=http://services.brightcove.com/services&amp;cdnURL=http://admin.brightcove.com&amp;domain=embed&amp;autoStart=false&amp;" /><param name="src" value="http://c.brightcove.com/services/viewer/federated_f8/1570028817" /></object><br />
The current SNP Dr. prototype can actively demonstrate a number of SNPs on a single chip, but there&#8217;s still a good deal of work to be done for a cotton swab of spit to interface with information technology.  Toumazou says that they are already working with Pfizer, and other pharmaceutical companies on predicting drug responses in patients.</p>
<p>Prof. Toumazou is confident SNP Dr products can be developed and launched fairly quickly. Unregulated uses of DNA testing (such as having 23andMe looking at your genetic traits) could start adopting SNP Dr within the next 1-2yrs.  Genomic studies, drug responses, and infection detection are all highly regulated, rightfully so, and will take a little longer to approve the new technology. According to Toumazou, These more rigorous uses of SNP Dr. will probably be seen in 2-5 years.</p>
<p><strong>A SNP Dr. in every home</strong></p>
<div id="attachment_7600" class="wp-caption alignright" style="width: 340px"><img class="size-medium wp-image-7600 " title="dr-leila-shepherd-dna-electronics-snp" src="http://singularityhub.com/wp-content/uploads/2009/09/dr-leila-shepherd-dna-electronics-snp-300x200.jpg" alt="CTO Dr. Leila Shepherd works to bring SNP Dr to market." width="330" height="220" /><p class="wp-caption-text">CTO Dr. Leila Shepherd works to bring SNP Dr to market.</p></div>
<p>In terms of the overall business model, integrating genetics and semiconductor chips is still a very new field and a number of opportunities may emerge, from selling the handheld SNP Dr, to producing new and updated disposable SNP chips on a regular basis. But no matter where the most revenue may lie for DNA Electronics, you can bet they are going to make a big impact. For a couple of hundred dollars, almost any professional could buy a SNP Dr, a whole bag of SNP chips and get to testing. Doctors, farmers, soldiers, forensic scientists, cosmetic counter artists, personal trainers, or just the interested layman could suddenly test themselves and others for important genetic traits. Some of that activity is bound to be regulated, but it still leaves plenty of room for the SNP Dr. to find its place in the world.</p>
<p>It may be a very important place. With the ability to create new SNP chips at the rate of current silicon technologies (ask Intel how fast that is) we could see SNP Dr. become a rapid response tool in the fight against biological threats. Terrorist weapons? Sure, but think about infectious diseases like swine flu, blights on crops, or allergies to medicines. If scientists can find a SNP, DNA electronics can build a SNP chip for it. &#8220;Anything that has a defined sequence,&#8221; says Toumazou, is fair game. After all, &#8220;it&#8217;s not discovery, it&#8217;s matching.&#8221;</p>
<p>In fact, concentrating on matching doesn&#8217;t just make SNP Dr. fast and reliable, it also makes it a logician. Toumazou says that SNP chips could be geared towards boolean logic. Does this organism have gene X AND gene Y?  That enhances the applications we&#8217;ve already discussed and makes the technology a boon to synthetic biology. Anything a scientist can define a sequence for, DNA Electronics can help them detect in minutes. Genetic engineers will be able to search and sort their creations for traits nearly in real time. That&#8217;s going to lead to some amazing developments.</p>
<p><strong>An ounce of prevention</strong></p>
<p>As I&#8217;ve said before, Toumazou is also the brains behind Sensium which will help health monitoring. Along with SNP Dr, we start to see a clear trend: the more you know, the healthier you can live. Toumazou is working to &#8220;change healthcare in the future, if you want to call it healthcare.&#8221; Maybe the new paradigm is lifestyle management or lifecare. Why wait until you are ill to learn what will make you sick? Why wait until you are fat to learn how much exercise you need? Working with your doctors,  human and hand held, will help answer these questions before they become problems.</p>
<p>Which is really the promise of merging semiconductors with genetics. Cutely named devices are great, but widespread improvements in healthcare are better. The possibility that anyone with the interest could affordably test themselves for genetic traits is amazing. That may alter the way we think of genetic information, our health, or even our identities. These are game-changing trends, and it&#8217;s exciting to see them make their way to market. Hopefully DNA Electronics, and Prof. Toumazou will   develop the biological sampling side of the SNP Dr. as quickly as planned so that we can start seeing the benefits of those trends in a few years.</p>
<p>After that, its back to breeding different technologies to produce crazy offspring devices. Particle colliders and Twitter&#8230;<a title="singularity-hub-tweetbomb" href="http://singularityhub.com/2009/04/22/tweetbomb-a-tweet-to-shake-the-world/" target="_blank">Tweetbomb</a>?</p>
<p><em>[photos courtesy of DNA Electronics]</em></p>
<p><em>[video credit: Number10TV]</em></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2009/10/13/ibm-hypes-dna-transistor-sequencing-genomes-for-less-than-1000/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="IBM Hypes DNA Transistor, Genomes for Less than $1000" title="IBM Hypes DNA Transistor, Genomes for Less than $1000" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/10/13/ibm-hypes-dna-transistor-sequencing-genomes-for-less-than-1000/" rel="bookmark" class="crp_title">IBM Hypes DNA Transistor, Genomes for Less than $1000</a></li><li><a href="http://singularityhub.com/2009/10/12/new-cancer-detector-chip-works-in-about-30-minutes/" rel="bookmark"><img width="200" height="144" src="http://singularityhub.com/wp-content/uploads/2009/10/cancer-detector-chip.jpg" class="crp_thumb wp-post-image" alt="New Cancer Detector Chip Works in About 30 Minutes" title="New Cancer Detector Chip Works in About 30 Minutes" border="0" /></a> <a href="http://singularityhub.com/2009/10/12/new-cancer-detector-chip-works-in-about-30-minutes/" rel="bookmark" class="crp_title">New Cancer Detector Chip Works in About 30 Minutes</a></li><li><a href="http://singularityhub.com/2011/04/11/free-dna-analysis-from-23andme-good-gimmick-tired-technology/" rel="bookmark"><img width="200" height="146" src="http://singularityhub.com/wp-content/uploads/2011/04/23andme-sale.jpg" class="crp_thumb wp-post-image" alt="Free DNA Analysis From 23andMe &#8211; Good Gimmick, Tired Technology?" title="Free DNA Analysis From 23andMe &#8211; Good Gimmick, Tired Technology?" border="0" /></a> <a href="http://singularityhub.com/2011/04/11/free-dna-analysis-from-23andme-good-gimmick-tired-technology/" rel="bookmark" class="crp_title">Free DNA Analysis From 23andMe &#8211; Good Gimmick, Tired Technology?</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2009/09/30/dna-electronics-has-a-hand-held-genetic-testing-device-interview-with-ceo/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Get Your Entire Genome From Complete Genomics For $5000</title>
		<link>http://singularityhub.com/2009/08/28/get-your-entire-genome-from-complete-genomics-for-5000/</link>
		<comments>http://singularityhub.com/2009/08/28/get-your-entire-genome-from-complete-genomics-for-5000/#comments</comments>
		<pubDate>Fri, 28 Aug 2009 17:00:17 +0000</pubDate>
		<dc:creator>Aaron Saenz</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[cliff reid]]></category>
		<category><![CDATA[complete genomics]]></category>
		<category><![CDATA[daniel macarthur]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[Genetic Future]]></category>
		<category><![CDATA[genome]]></category>
		<category><![CDATA[illumina]]></category>
		<category><![CDATA[pacific biosciences]]></category>
		<category><![CDATA[sequence]]></category>
		<category><![CDATA[sequencing]]></category>

		<guid isPermaLink="false">http://singularityhub.com/?p=6555</guid>
		<description><![CDATA[It&#8217;s getting progressively cheaper to sequence your entire genome. Earlier in June, Illumina announced it would provide sequencing for close [...]]]></description>
			<content:encoded><![CDATA[<p style="margin-bottom: 0in;">
<div id="attachment_6556" class="wp-caption alignleft" style="width: 293px"><img class="size-medium wp-image-6556" title="cheap-genome-sequence" src="http://singularityhub.com/wp-content/uploads/2009/08/cheap-genome-sequence-283x300.jpg" alt="Complete Genomics is pushing down the costs of sequencing the human genome." width="283" height="300" /><p class="wp-caption-text">Complete Genomics is pushing down the costs of sequencing the human genome.</p></div>
<p>It&#8217;s getting progressively cheaper to sequence your entire genome. Earlier in June, <a title="Illumina" href="http://www.illumina.com/" target="_blank">Illumina</a> announced it would provide sequencing for close to $50k, half of their original price. Not to be outdone, <a title="Complete Genomics" href="http://www.completegenomics.com/default.aspx" target="_blank">Complete Genomics</a> just released on Monday that it had gathered <a title="Complete-genomics-press-release" href="http://www.completegenomics.com/pages/materials/financing_pressRelease.pdf" target="_blank">$45 million dollars in funding</a>. The Silicon Valley based company is planning to use that money to further develop their streamline sequencing operations so that they can offer a complete genome for just $5000 by next year. CG&#8217;s goal is to finish 10,000 sequences by years end 2010. Even though that&#8217;s later than we had hoped, it&#8217;s still a whole lot of DNA and at the cheapest price for a whole genome seen so far. The question is, can they really pull it off?</p>
<p>We&#8217;ve been looking for a company, any company really, to <a title="singularity-hub-1000-complete-genome" href="http://singularityhub.com/2008/12/30/whole-genome-sequencing-to-cost-only-1000-by-end-of-2009/" target="_blank">break the $1000 price mark for a complete genome</a> sequencing sometime in the next few years. That&#8217;s about the point where retail sales of the service will explode. With their exponentially decreasing price tag, Complete Genomics might be on that path. However, we know of at least one company that is trying to reach that goal by the end of this year. Stay tuned for that story in the next few weeks.</p>
<p><span id="more-6555"></span></p>
<p style="margin-bottom: 0in;">If you&#8217;ve never heard of Complete Genomics, read our <a title="singularity-hub-complete-genomics" href="http://singularityhub.com/2009/02/06/complete-genomics-stuns-genomics-community-confirms-industry-shattering-capability/" target="_blank">first</a> and <a title="singularity-hub-complete-genomics" href="http://singularityhub.com/2009/02/10/complete-genomics-new-information-about-the-hottest-company-in-genetic-sequencing/" target="_blank">second</a> story to catch up. Basically they use a common form of short read sequencing and throw in a ton of computer power to sequence a human genome. Interest in personal genomics is escalating as genetic links to diseases are discovered. 23andMe already offers some testing for such diseases and is <a title="singularity-hub-23andme-research-revolution" href="http://singularityhub.com/2009/08/17/23andme-leading-way-to-democratized-disease-research/" target="_blank">hoping to gather samples for further clinical trials</a>. By providing the entire genome for perusal on the cheap, CG could make it economically feasible to expand that research into many more illnesses. Already, we&#8217;ve shown you how some facilities are <a title="singularity-hub-fraud-genetic-testing" href="http://singularityhub.com/2009/08/13/genetic-testing-of-chinese-children-fraud-and-future/" target="_blank">erroneously promising to predict a child&#8217;s aptitude</a> based on genetic sampling. Perhaps with the cheap sequencing CG could provide, scientific research will match pace with the growing demand for such testing.</p>
<p style="margin-bottom: 0in;"><a title="Genetic-future-complete-genomics" href="http://scienceblogs.com/geneticfuture/2009/08/complete_genomics_back_in_acti_1.php" target="_blank">Daniel MacArthur of Genetic Future</a> was able to pry CG head Cliff Reid to provide some details  in how they hope to achieve their goals. First, Reid disclosed that the test won&#8217;t be offered directly to consumers, but rather through retail providers such as Knome and 23andMe. That means the price you or I will see could be considerably higher than $5k. Whatever the retail price, Reid promises 120 billion base pairs sequenced, 98% of the genome, with just one error in 10,000. That&#8217;s considerably better stats than what CG offered in February (92% of genome, about one error in 1,000).</p>
<p style="margin-bottom: 0in;">Between now and year&#8217;s end 2009, Complete Genomics will focus on its dozens of customers currently in the line up. These include the <a title="Broad-Institute" href="http://www.broad.mit.edu/" target="_blank">Broad Institute</a> out of MIT and Harvard which announced it was purchasing at least 5 genomes from CG in March. The Broad Institute reportedly paid $20k for each of their genomes which might be taken as the current baseline price for CG customers. If so, that&#8217;s a factor of four that the company has to make up between now and next year.</p>
<p style="margin-bottom: 0in;">But scaling is no problem for genome sequencing. Remember that it took 15 years to sequence the first human genome, but the next 6 were done in 24 months. Now we&#8217;re talking about doing thousands a year. That&#8217;s just nuts and one of the amazing parts about sequencing that I love. Exponential growth is sexy science. And it&#8217;s supposed to be one of CG&#8217;s strengths. They just finished their first genome in the summer of 2008, and are now on schedule to finish 100 by the end of 2009. Current estimates of finishing 1000 by mid 2010, and 9000 more by the end of that year fit within the exponential growth curve. As MacArthur points out, most of these sequencing services will likely be purchased by researchers in genomic and cancer studies. So the demand is also there.</p>
<p style="margin-bottom: 0in;">How can CG scale so quickly? By remaining inflexible but efficient. Their process doesn&#8217;t rely on making huge improvements in sequencing technology. Or finding a new sequencing technique. It comes down to streamlining the process. Stick to one task, human genome sequencing, miniaturize whenever possible, fewer reagents means lower costs, and build build build. You can bet a huge portion of that $45 million is going to expanding <a title="singularity-hub-complete-genomics" href="http://singularityhub.com/2009/02/06/complete-genomics-stuns-genomics-community-confirms-industry-shattering-capability/" target="_blank">their facilities in Mountain View</a>.</p>
<p style="margin-bottom: 0in;">Who provides the cheap genomes is probably less important than the change it will create. While scientific research will undoubtedly benefit first, the public at large will likely become a dominant consumer. Genetic information is on the journey to becoming one of the most important sets of data someone can know about themselves, with insights into disease, aptitudes, and longevity. Give us the chance for cheap access to that info and you&#8217;ll never run out of customers. Just a little while longer, it&#8217;s bound to happen.</p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2010/02/22/complete-genomics-secures-new-customers-500-orders-for-whole-genome-sequences/" rel="bookmark"><img width="200" height="142" src="http://singularityhub.com/wp-content/uploads/2010/02/complete-genomics-lab.jpg" class="crp_thumb wp-post-image" alt="Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences" title="Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences" border="0" /></a> <a href="http://singularityhub.com/2010/02/22/complete-genomics-secures-new-customers-500-orders-for-whole-genome-sequences/" rel="bookmark" class="crp_title">Complete Genomics Secures New Customers, 500+ Orders for Whole Genome Sequences</a></li><li><a href="http://singularityhub.com/2009/09/09/complete-genomics-press-release-nearly-doubled-the-number-of-sequenced-human-genomes-since-march/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Sequenced Human Genomes Nearly Doubled Since March" title="Sequenced Human Genomes Nearly Doubled Since March" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/09/09/complete-genomics-press-release-nearly-doubled-the-number-of-sequenced-human-genomes-since-march/" rel="bookmark" class="crp_title">Sequenced Human Genomes Nearly Doubled Since March</a></li><li><a href="http://singularityhub.com/2009/02/10/complete-genomics-new-information-about-the-hottest-company-in-genetic-sequencing/" rel="bookmark"><img width="200" height="146" src="http://singularityhub.com/wp-content/uploads/2009/02/complete-genomics-genes.jpg" class="crp_thumb wp-post-image" alt="Complete Genomics &#8211; New Information About the Hottest Company in Genetic Sequencing" title="Complete Genomics &#8211; New Information About the Hottest Company in Genetic Sequencing" border="0" /></a> <a href="http://singularityhub.com/2009/02/10/complete-genomics-new-information-about-the-hottest-company-in-genetic-sequencing/" rel="bookmark" class="crp_title">Complete Genomics &#8211; New Information About the Hottest Company in Genetic Sequencing</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2009/08/28/get-your-entire-genome-from-complete-genomics-for-5000/feed/</wfw:commentRss>
		<slash:comments>10</slash:comments>
		</item>
		<item>
		<title>Archon X Prize Offers $10 million to Revolutionize Gene Sequencing</title>
		<link>http://singularityhub.com/2008/07/25/archon-x-prize-offers-10-million-to-revolutionize-gene-sequencing/</link>
		<comments>http://singularityhub.com/2008/07/25/archon-x-prize-offers-10-million-to-revolutionize-gene-sequencing/#comments</comments>
		<pubDate>Fri, 25 Jul 2008 04:17:24 +0000</pubDate>
		<dc:creator>Keith Kleiner</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[Archon]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[genes]]></category>
		<category><![CDATA[sequencing]]></category>
		<category><![CDATA[X Prize]]></category>

		<guid isPermaLink="false">http://singularityhub.com/2008/07/25/archon-x-prize-offers-10-million-to-revolutionize-gene-sequencing/</guid>
		<description><![CDATA[Many people have heard of the original X Prize, which was a $10 million prize given to the first company [...]]]></description>
			<content:encoded><![CDATA[<p>Many people have heard of the <a href="http://space.xprize.org/ansari-x-prize">original X Prize</a>, which was a $10 million prize given to the first company that could build a spacecraft capable of carrying three people to 100 kilometers above the earth&#8217;s surface, twice within two weeks.  Many people are unaware that this original X Prize has since spawned an entire family of other <a href="http://www.xprize.org/">$10 million X Prize challenges</a> that are ongoing today.</p>
<p>The <a href="http://genomics.xprize.org/">Archon X Prize</a> is offering $10 million &#8220;to the first Team that can build a device and use it to sequence 100<br />
human genomes within 10 days or less, with an accuracy of no more than<br />
one error in every 100,000 bases sequenced, with sequences accurately<br />
covering at least 98% of the genome, and at a recurring cost of no more<br />
than $10,000 per genome.&#8221;</p>
<p>The Archon X Prize will accelerate mankind&#8217;s efforts to achieve affordable and fast sequencing and analysis of the DNA for every individual on the planet.  Once this capability is a reality it will unleash a revolution in our ability to make people healthier, fight disease, and even improve people beyond their original genetic and biological bodies.</p>
<p><a href="http://singularityhub.com/wp-content/uploads/2008/07/genomicswhite4-28.jpg"><img class="alignnone size-full wp-image-59" title="genomicswhite4-28" src="http://singularityhub.com/wp-content/uploads/2008/07/genomicswhite4-28.jpg" border="0" alt="" width="230" height="232" /></a></p>
<h4>Picture from Archon X Prize Website</h4>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2009/05/04/bid-to-have-your-whole-genome-sequenced-on-ebay/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Bid To Have Your Whole Genome Sequenced On Ebay" title="Bid To Have Your Whole Genome Sequenced On Ebay" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/05/04/bid-to-have-your-whole-genome-sequenced-on-ebay/" rel="bookmark" class="crp_title">Bid To Have Your Whole Genome Sequenced On Ebay</a></li><li><a href="http://singularityhub.com/2008/12/30/whole-genome-sequencing-to-cost-only-1000-by-end-of-2009/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Whole Genome Sequencing To Cost Only $1,000 By End Of 2009" title="Whole Genome Sequencing To Cost Only $1,000 By End Of 2009" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2008/12/30/whole-genome-sequencing-to-cost-only-1000-by-end-of-2009/" rel="bookmark" class="crp_title">Whole Genome Sequencing To Cost Only $1,000 By End Of 2009</a></li><li><a href="http://singularityhub.com/2010/01/25/kurzweil-discusses-the-future-of-brain-computer-interfaces-at-x-prize-lab-video/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Kurzweil Discusses the Future of Brain Computer Interfaces (Video)" title="Kurzweil Discusses the Future of Brain Computer Interfaces (Video)" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2010/01/25/kurzweil-discusses-the-future-of-brain-computer-interfaces-at-x-prize-lab-video/" rel="bookmark" class="crp_title">Kurzweil Discusses the Future of Brain Computer Interfaces (Video)</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2008/07/25/archon-x-prize-offers-10-million-to-revolutionize-gene-sequencing/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Heliscope builds world&#8217;s fastest DNA sequencer</title>
		<link>http://singularityhub.com/2008/07/14/heliscope-builds-worlds-fastest-dna-sequencer/</link>
		<comments>http://singularityhub.com/2008/07/14/heliscope-builds-worlds-fastest-dna-sequencer/#comments</comments>
		<pubDate>Mon, 14 Jul 2008 16:58:33 +0000</pubDate>
		<dc:creator>Keith Kleiner</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[dna]]></category>
		<category><![CDATA[DNA sequencer]]></category>
		<category><![CDATA[helicos]]></category>
		<category><![CDATA[heliscope]]></category>
		<category><![CDATA[pcr]]></category>

		<guid isPermaLink="false">http://singularityhub.com/2008/07/14/heliscope-builds-worlds-fastest-dna-sequencer/</guid>
		<description><![CDATA[The Short: Technology Review reports that for just $1,350,000 USD you can have have the worlds fastest commercially available DNA [...]]]></description>
			<content:encoded><![CDATA[<p><strong>The Short:<br />
</strong>Technology Review <a href="http://www.technologyreview.com/Biotech/20947/?a=f">reports</a> that for just <a href="http://www.helicosbio.com/Products/Pricing/tabid/150/Default.aspx">$1,350,000 USD</a> you can have have the worlds fastest commercially available DNA sequencer, called the Heliscope.  The machine developed by <a href="http://www.helicosbio.com/">Helicos BioSciences</a> takes just one hour to read 1.3 billion base pairs from a strand of DNA.  Here is a picture of the beauty:</p>
<p style="text-align: center;"><a href="http://singularityhub.com/wp-content/uploads/2008/07/heliscope-showcase1.jpg"><img class="alignnone size-medium wp-image-22 aligncenter" title="heliscope-showcase1" src="http://singularityhub.com/wp-content/uploads/2008/07/heliscope-showcase1.jpg" border="0" alt="The Heliscope" /></a></p>
<p style="text-align: center;"><span id="dnn_ctr440_dnnTITLE_lblTitle" class="Head">HeliScope™ Single Molecule Sequencer</span></p>
<p><strong>The Long:</strong><br />
The Heliscope is being marketed as a DNA microscope.  It is unique in the field of DNA sequencing because it sequences an actual DNA strand whereas most other sequencing technologies use PCR to create millions of copies of an original DNA template and then parallelize the analysis of these millions of strands.  Although PCR based technologies can compete with the Heliscope on speed, only the heliscope offers analysis of an actual single strand of DNA.  The millions of copies created from PCR based technologies differ slightly from the original template strand due to very rare but significant copying errors that occur during the creation of the copies and hence some of the information from the original strand is lost.  From the article:<br />
<em><br />
&#8220;The technology is so new that it&#8217;s not yet clear what applications it<br />
will be best suited to. But some scientists believe that<br />
single-­molecule sequencing could be particularly important in<br />
understanding how genetic variations contribute to disease. After all,<br />
some rare mutations linked to disease may have been missed in previous<br />
genomic studies because they weren&#8217;t copied during the amplification<br />
process.&#8221;</em></p>
<p>Both PCR and single strand based analyses have their place in genetics, but if you are doing single strand analysis then Helicose has the machine for you!</p>
<p>Like other DNA sequencing technologies, the Heliscope uses fluorescently tagged DNA to &#8220;see&#8221; the DNA sequence, but the Heliscope is unique in its ability to see individual fluroescence of a single base as noted in these quotes:</p>
<p><em>&#8220;Once the fluorescently tagged base is incorporated into the new strand,<br />
the HeliScope&#8217;s camera can spot the light it emits. &#8220;The imager detects<br />
a plume&#8211;a 200-­nanometer cone of light&#8211;from the integration of a<br />
single [base] onto a ­single strand of DNA,&#8221;</em></p>
<p>and</p>
<p><em>&#8220;But unlike those technologies, the HeliScope can distinguish the<br />
unamplified fluorescent signal of a single base taking its place on a<br />
growing DNA strand. One key to that ability is a nonstick material that<br />
the company developed, which coats the surface of the flow cell and<br />
allows it to be washed clean between reactions: residual fluorescent<br />
bases would make it more difficult to accurately detect individual<br />
sequencing reactions. &#8220;You need to make sure no extra base molecules<br />
are sticking to the surface,&#8221; says Patrice Milos, chief scientific<br />
officer at Helicos. &#8220;This was one of the biggest early challenges.&#8221;<br />
After each cycle, the fluorescent markers are clipped from the newly<br />
incorporated bases, and remaining chemicals are washed away. The<br />
process is repeated sequentially with each of the four bases.&#8221;</em></p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2008/07/11/manipulation-of-large-dna-strands-with-microhook-and-microspool/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Manipulation of large dna strands with microhook and microspool" title="Manipulation of large dna strands with microhook and microspool" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2008/07/11/manipulation-of-large-dna-strands-with-microhook-and-microspool/" rel="bookmark" class="crp_title">Manipulation of large dna strands with microhook and microspool</a></li><li><a href="http://singularityhub.com/2008/07/25/archon-x-prize-offers-10-million-to-revolutionize-gene-sequencing/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Archon X Prize Offers $10 million to Revolutionize Gene Sequencing" title="Archon X Prize Offers $10 million to Revolutionize Gene Sequencing" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2008/07/25/archon-x-prize-offers-10-million-to-revolutionize-gene-sequencing/" rel="bookmark" class="crp_title">Archon X Prize Offers $10 million to Revolutionize Gene Sequencing</a></li><li><a href="http://singularityhub.com/2009/10/13/ibm-hypes-dna-transistor-sequencing-genomes-for-less-than-1000/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="IBM Hypes DNA Transistor, Genomes for Less than $1000" title="IBM Hypes DNA Transistor, Genomes for Less than $1000" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/10/13/ibm-hypes-dna-transistor-sequencing-genomes-for-less-than-1000/" rel="bookmark" class="crp_title">IBM Hypes DNA Transistor, Genomes for Less than $1000</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2008/07/14/heliscope-builds-worlds-fastest-dna-sequencer/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
		</item>
		<item>
		<title>The revolution in mass market DNA analysis is happening&#8230;</title>
		<link>http://singularityhub.com/2008/07/10/the-revolution-in-mass-market-dna-analysis-is-happeningdont-let-it-sneak-up-on-you/</link>
		<comments>http://singularityhub.com/2008/07/10/the-revolution-in-mass-market-dna-analysis-is-happeningdont-let-it-sneak-up-on-you/#comments</comments>
		<pubDate>Thu, 10 Jul 2008 23:05:02 +0000</pubDate>
		<dc:creator>Keith Kleiner</dc:creator>
				<category><![CDATA[Genetics]]></category>
		<category><![CDATA[dna]]></category>

		<guid isPermaLink="false">http://singularityhub.com/2008/07/10/the-revolution-in-mass-market-dna-analysis-is-happeningdont-let-it-sneak-up-on-you/</guid>
		<description><![CDATA[I just read the following post from the 23andMe company blog. The most interesting revelation here is the demonstration of [...]]]></description>
			<content:encoded><![CDATA[<p>I just read the following <a href="http://spittoon.23andme.com/2008/07/10/the-family-that-spits-together%e2%80%a6/#more-319">post </a>from the  <a class="external text" title="http://www.23andme.com/" href="http://www.23andme.com/">23andMe</a> company blog.  The most interesting revelation here is the demonstration of how easy it is for a person to find a compatible organ donor once their DNA is scanned and compared against the DNA of other individuals in the database.  </p>
<p>Less than ten years ago an enormous scientific endeavor to <a href="http://en.wikipedia.org/wiki/Human_Genome_Project">decode a single human genome</a> was completed with the expenditure of millions of dollars and more than a decade of intense effort.  <strong>Today, for less than $1,000 you can have your own individual DNA analyzed in a matter of weeks!</strong> The ability to analyze the DNA of an individual cheaply and quickly represents a revolution in the way mankind will be able to manipulate the human body.  Stick with us here at singularity hub and be in the know as the revolution unfolds.</p>
<p>In the next month or so I will be having my DNA analyzed by the two leading companies in the field,  <a class="external text" title="http://www.23andme.com/" href="http://www.23andme.com/">23andMe</a> and <a class="external text" title="http://www.decodeme.com/" href="http://www.decodeme.com/">deCODEme</a>.  In depth analysis of my experience at both companies will be posted here as soon as possible so stay tuned.</p>
<div id="crp_related"><ul><li><a href="http://singularityhub.com/2008/07/08/check-yourself-for-genetic-abnormalities-wired-how-to-wiki-2/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Check Yourself for Genetic Abnormalities Wiki" title="Check Yourself for Genetic Abnormalities Wiki" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2008/07/08/check-yourself-for-genetic-abnormalities-wired-how-to-wiki-2/" rel="bookmark" class="crp_title">Check Yourself for Genetic Abnormalities Wiki</a></li><li><a href="http://singularityhub.com/2009/06/19/google-papa-brin-step-in-for-23andme/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="Google, Papa Brin Step In For 23andme" title="Google, Papa Brin Step In For 23andme" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/06/19/google-papa-brin-step-in-for-23andme/" rel="bookmark" class="crp_title">Google, Papa Brin Step In For 23andme</a></li><li><a href="http://singularityhub.com/2009/03/12/23andme-declares-war-on-parkinsons-army-of-10000-to-give-dna/" rel="bookmark"><img src="http://singularityhub.com/wp-content/plugins/contextual-related-posts/default.png" alt="23andMe Declares War On Parkinson&#8217;s &#8211; Army Of 10,000 To Give DNA" title="23andMe Declares War On Parkinson&#8217;s &#8211; Army Of 10,000 To Give DNA" width="200" height="200" border="0" class="crp_thumb" /></a> <a href="http://singularityhub.com/2009/03/12/23andme-declares-war-on-parkinsons-army-of-10000-to-give-dna/" rel="bookmark" class="crp_title">23andMe Declares War On Parkinson&#8217;s &#8211; Army Of 10,000 To Give DNA</a></li></ul></div>]]></content:encoded>
			<wfw:commentRss>http://singularityhub.com/2008/07/10/the-revolution-in-mass-market-dna-analysis-is-happeningdont-let-it-sneak-up-on-you/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
	</channel>
</rss>

<!-- Performance optimized by W3 Total Cache. Learn more: http://www.w3-edge.com/wordpress-plugins/

Served from: singularityhub.com @ 2012-02-09 14:40:04 -->

<!-- W3 Total Cache: Page cache debug info:
Engine:             disk (enhanced)
Cache key:          tag/dna/feed/_index.html
Caching:            enabled
Status:             not cached
Creation Time:      2.535s
Header info:
X-CF-Powered-By:    WP 1.1.9
X-Pingback:         http://singularityhub.com/xmlrpc.php
ETag:               "359214ea0a06b697ee84cd4e6ea1745f"
Content-Type:       text/xml; charset=UTF-8
Last-Modified:      Thu, 09 Feb 2012 22:40:04 GMT
Vary:               Cookie
X-Powered-By:       W3 Total Cache/0.9.2.3
-->
