Synthetic biology is poised to become one of the big technologies of the 21st Century – a game changing area of science that could alter everything we know about health, energy, and humanity. But if the synthetic biology revolution ever wants to get off the ground, it’s going to need a new wave of entrepreneurs to develop companies and establish the industry. Singularity University is looking for those entrepreneurs…and it’s going to help them succeed. The Synbio Startup Launchpad is SU’s latest effort to empower the next generation of business leaders with the disruptive influence of accelerating technologies. Using software incubators as a model, the Synbio Startup Launchpad will give top tier startups up to $50k in funds, supplies, and lab services. They also provide mentors, a community of peers, and Singularity University’s unparalleled network of investors and partners. The first session for the Synbio Startup Launchpad will run May to August this year and Singularity University is actively seeking qualified applicants. Apply online soon, the deadline is close: April 1st. Synthetic biology incubators are a nearly unexplored space in the investment world, so who better than SU to lead the way into the future of this most exciting technology.

Not that Singularity University is doing it all alone. Far from it. SU has partnered with some great names in the field. It was Andrew Hessel (a big synbio advocate), and John Cumbers of NASA AMES who first brought the idea to SU. Triple Ring Technologies is co-leading the program and providing wet lab space and services. Science Exchange will give each startup up to $2500 in science service discounts. BioCurious is opening their doors to all the Synbio Startup Launchpad participants, with Eri Gentry also serving as a mentor. In fact, looking through the list of partners, faculty, and mentors involved, it’s hard not to get excited. These are the people you want on your team when you venture into unknown biological territory.

Like many other incubators in other fields, the Synbio Startup Launchpad is also providing the material considerations that every fledgling company needs. Stipends are good: $12k per company plus $3k per member for living expenses. Each business will also receive capital towards lab supplies and expenses, and access to facilities both at SU and Triple Ring Technologies. Business mentors, as well as tech mentors, will be provided for each group, and there will be guided introductions into a community of investors. That last bit alone is probably reason enough for any startup to apply to this session. In return for the mentoring, the money, and the meet and greets, Singularity University will be taking some equity – 6 to 8% depending – but that’s a pretty standard exchange, and follows the software-incubator style .

SU's Gabriel Baldinucci is developing the Synbio Startup Launchpad, with more ideas in the same vein coming in the years ahead.

Singularity Hub spoke with Gabriel Baldinucci, Vice President of Strategy and New Venture Development at SU. He highlighted the importance of the Synbio Startup Launchpad, both for the emerging field, and for the great vision of the university:

“Synthetic biology is a great example of a technology area undergoing exponential change. The continued lowering of costs is removing barriers and enabling the democratization of innovation in this space. Singularity University was the perfect place to create the first incubation program in this emerging field. We have the faculty and network to help these entrepreneurs succeed and we are looking to add some brilliant minds to our community of people working to solve humanity’s grand challenges.”

There are a few tech incubators out there whose brand is almost as powerful as the services they provide to their companies. TechCrunch’s Disrupt events, YCombinator – get the right pedigree from one of these groups and your new business will never lack for investors or interest. Synthetic biology, however, doesn’t have that brand…yet. I think Singularity University is going to create it with the Startup Synbio Launchpad. SU has the resources, the people, and the networking to serve as a great incubator. In fact, you could say that the SU Graduate Studies Program each summer, and (to a lesser extent) the Executive Programs already work as de facto incubators. They’ve certainly got enough emerging startups from those programs as evidence to that end. But what’s really exciting here, and what I think is really new, is the pairing of a such an incredible institution (SU) with such a powerful and under developed industry (synthetic biology). The seeds planted here could become huge influences in the future. The era of synthetic biology looks to have gotten much closer.

Want to get involved?
Startups apply here (April 1 deadline).
Prospective Investors and Partners go here, and contact Gabriel Baldinucci.

[image credit: Singularity University Synbio Startup Launchpad]
[source: Gabriel Baldinucci]

Venter, master of DNA, speaks bluntly to Der Spiegel about genetics.

“We have learned nothing from the genome.” That’s the grim message that J. Craig Venter recently gave Der Spiegel in an amazing interview. Venter, decoder of the human genome and creator of the world’s first fully synthetic bacteria, doesn’t pull any punches when describing the medical benefits we’ve derived from sequencing the human genome. They are “close to zero to put it precisely.” The Der Spiegel interview catches Venter in a blunt mood and we’re given a rare insight into how one of the foremost scientists in the field (probably the foremost scientist) see our progress thus far and our hopes for the future. To paraphrase: we haven’t really accomplished anything yet, people don’t want to believe that at all, and we’re finally taking the first steps to really understanding things now. Some of Venter’s juicier statements have me rethinking the current state of genomics. Check out the quotes below.

As we recently discussed, the 10 year anniversary of the Human Genome Project (and Venter’s competing and more successful Celera Genomics) has raised serious questions about what we have really learned from our foray into genomics. We’ve had success with in vitro screening for certain genetic illnesses, and we’ve used genetics to craft a few new medications, but the public at large has not seen a lot of benefit. Why?

Because we have, in truth, learned nothing from the genome other than probabilities. How does a 1 or 3 percent increased risk for something translate into the clinic? It is useless information.

We’ve seen personal DNA testing become a burgeoning product, with companies like Pathway Genomics, 23andMe, and Navigenics offering to scan your genome for important genes (SNPs) and tell you what their presence may mean. Such tests are all about probabilities, and many have raised the same concerns as Venter – that we what we learn from such studies is practically useless. I for one, enjoyed my DNA test, but mostly for the educational merit. I’ve haven’t changed a single habit in response to the data I was given. Why?

we need a lot more information: Information about your body’s chemistry, your physiology, your complete medical history, your brain and your entire life. We would need to do that a million times on different people and correlate that data with their genetic information.

Essentially we have more DNA than understanding. Until we can correlate massive amounts of genetic data with real-world effects we really don’t know what to tell people when we give them results to personal DNA tests. Even those that have had their whole genome sequenced (not just SNPs) don’t really have much insight into their lives. As Venter says about his own experience with sequencing: “We couldn’t even be certain from my genome what my eye color was.”

But efforts are already underway to correlate medical histories with DNA. We’ve already discussed biobanks of hundreds of thousands of patients that are being created over the next decade. With cheaper whole genome sequencing it will eventually be possible for us to examine this rich pool of data and perhaps discover meaningful and useful insight into how genes affect our bodies and health. What happens then?

It’s not, ‘Oh, we know your genome, we’re going to make this drug for you.’ That will never happen. It is more important that you use the information in the genome about your personal risks and reduce them through intelligent behavior.

I heartedly agree on the last part, but object to the first. We don’t know if it will be practical to tailor drugs to individuals (probably cost prohibitive) but I think it is likely that we’ll be able to customize treatments. Doctors already do that for every patient without a lot of knowledge about genetics. In the future we may not create entirely new medications for each patient but we’re very likely to use fast chip processing to give doctors an idea which drugs will react poorly with the patient due to genetic predisposition. Given enough possible combination of medications the difference between custom making drugs and custom designing a cocktail of them will seem slight. In my opinion.

If you think that Venter’s comments in Der Spiegel are unbearably gloomy, you haven’t read enough of the interview. Yes, the first third is mainly Venter trash talking about Francis Collins, and the second third chastises everyone for thinking that genetics was some magical cure-all or some dreaded infringement on God’s turf. The last bit, however, reveals where Venter’s hopes seem to lie: in creating new life from scratch.

We don’t even know how the simplest bacterial cell works. We want to learn what the minimum cellular components are, so we’re going to be taking out all the non-essential genes.

He’s already assembled bacteria from the building blocks of DNA, and now he has his sights on using that technology to really advance our understanding of genetics. He and his team plan on building a ‘minimal cell’ – the simplest form of bacterial life you can make and still have survive. The hope is that this will lead to a greater understanding of what it takes to be an organism – to understand the basic components and operating system of cellular life.

From that understanding could come the ability to truly design organisms from the ground up. We could design bacteria that produce complex carbon compounds and reduce our need for oil. Exxon Mobile has invested $600 million with Venter in the hopes of creating these new life forms which could radically alter the availability of resources all over the world. Think of what the organisms we design may be able to produce.

Not only gasoline. Plastic, asphalt, heating oil: Everything that we make from oil will at some point be made by bacteria or other cells. Whether that is in five, 10 or 20 years is unclear. Why don’t we have fuel now other than alcohol from microbes? It’s because nothing evolved that can produce great amounts of biofuel out of CO2. That’s why we have to make it.

Venter’s vision of the future seems to be as hopeful as his vision of the past is disdainful. There is so much power in genetic engineering and synthetic biology that it’s hard to fully grasp both its limitations and its potential. If there is one message to take away from Venter’s comments I think it is this: we need more understanding. Thankfully there are many, including Venter and his colleagues, who are pursuing that understanding with a fiery passion.

All quotes are J. Craig Venter,2010 as taken from Der Spiegel. The full Der Spiegel interview with J. Craig Venter conducted by Rafaela von Bredow and Johann Grolle can be found here. It is awesome. Read it.

[image credit]
[source: Der Spiegel]

As we previously reported, the International Open Facility Advancing Biotechnology (BIOFAB) is a project to produce thousands of standardized genetic “parts” for researchers to use in the pioneering work of synthetic biology. Started with a seed grant from the National Science Foundation (NSF), BIOFAB is the world’s very first biological design-build facility. They will be providing bioparts to researchers gratis to speed along national research into new drugs, biofuels, chemicals, you name it – all the promising frontiers of synthetic biology. And they should be open for business within 6 months.

So what exactly is a synthetic biology “part”? Good question – that was exactly the topic of the project’s first human practices report (found here). The short answer is that biological parts are small snippets of DNA with basic, well-understood functions (e.g. the production of a certain protein). Building a microbe from scratch is no easy task, especially if you have to identify and characterize all of these building blocks yourself. That’s exactly what synthetic biologists have been doing – it costs millions of dollars and takes years of legwork.

Synthetic biology is an emerging field that combines biology and engineering to reconfigure DNA into desirable results, generally microorganisms that can be used to produce drugs, perform chemical reactions, or work as fuels. But because the field is so new, there haven’t yet been standards set for what works and what doesn’t. Characterizing these basic components (and providing them) will give a common engineering language for researchers working on very different problems. It will also make potential progress faster and cheaper.

BIOFAB director Drew Endy (Stanford) and co-director Adam Arkin (UC Berkeley)

But researchers will still have their work cut out for them. One of the most problematic issues for synthetic biology – and one that BIOFAB deals with regularly – is that DNA snippets are only “parts” in the context of some “whole.” Genes work in complex networks, altering one another’s expression in interdependent ways; removed from the context of a larger genome, the function of any particular genetic strand changes. This makes the issue of isolating concrete characteristics to each part a difficult task: it acts differently depending on the surrounding DNA. It’s significant that this difficulty is precisely what has been a major road block for post-Genome Project genetics more generally.

So who sets the standards? Consider it Biology 2.0. Collaborative, open source efforts from many different labs have resulted in the emergence of what are called BioBrick standard parts. Many of these have been collected and housed at the Registry for Standard Biological Parts, founded in 2003 at MIT (we ran a story on this last year). The director of BIOFAB, Drew Endy of Stanford, was instrumental in shaping BioBrick part standards – and now his team is building a factory to provide them to the research world.

BIOFAB was launched in January of this year, and is currently a small scale operation (they have about 10 staff members total). The project is housed in a Lawrence Berkeley National Labs building in Emeryville, CA, and is a collaboration between researchers from UC Berkeley and Stanford (apparently despite the football rivalry). Perhaps a dubious award to some, BIOFAB was named “Best Local Innovator” by the East Bay Express, a Bay Area paper which also recommends the taco truck near my house. Suffice to say I trust their opinion.

Want to crack the code? The new synthetic bacteria has watermarks (WM1) encoded inside its DNA.

Researchers at the J Craig Venter Institute recently unveiled their first self-replicating synthetic bacteria (M. mycoides JCVI-syn1.0) whose DNA was ‘programmed’ base pair by base pair. To verify that they had synthesized a new organism and not assembled the DNA from another natural bacteria, scientists encoded a series of ‘watermarks’ into the genes of M. mycoides JCVI-syn1.0. There are four of these hidden messages: an explanation of the coding system used, a URL address for those who crack the code to go visit, a list of 46 authors and contributors, and a series of famous quotes. The presence of these watermarks verifies that M. mycoides JCVI-syn1.0 truly is synthetic and demonstrates the precision and power of JCVI’s new techniques in synthetic biology.

Craig Venter mentioned these watermarks in his interview with the journal Science, which published the most recent work with M. mycoides JCVI-syn1.0. Watch from 7:20 to 9:20 to hear him describe the idea:

This isn’t the first time that JCVI has been marking its territory. Back in 2008 when they were still working on getting a bacteria genome assembled they used the four ‘letters’ of DNA (G,A,T,C) to scribble a few words into its genetic code. These messages used codons, groups of three letters which code for amino acids, to stand for 20 letters of the alphabet. As such, some substitutions (like ‘v’ for ‘u’) were necessary. The results were relatively simple but still pretty cool:

• CRAIGVENTER coded as:
  TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA
• VENTERINSTITVTE coded as:
  TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTAACTAGCTAA
• HAMSMITH coded as:
  TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA
• CINDIANDCLYDE coded as:
  TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGCTAATGGGTC
  GATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATG
• GLASSANDCLYDE coded as:
  TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA

For the creation of M. mycoides JCVIsyn1.0, the J. Craig Venter Institute decided to produce much larger and more elaborate watermarks. Each of the four is more than one thousand base pairs long. Also, instead of coding for just 20 letters, the new system includes all letters and forms of punctuation for the English language. This makes it very unlikely that JCVI is using the codon system from 2008. Want to actually code the messages? Thankfully you won’t need to get a copy of M. mycoides JCVIsyn1.0 and sequence its DNA. In their publication in Science, JCVI included a figure (S.1) which lists the base pairs for each watermark. They have a diagram of the bacteria’s DNA (here as PDF) which may come in handy in case position in the genome has some bearing on the way the information is encoded. To make things even clearer, JCVI also released the quotes used in the fourth watermark. Here they are:

• “TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE.” – from James Joyce’s A Portrait of the Artist as a Young Man.
• “SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE.”- a quote from the book, American Prometheus which discusses J. Robert Oppenheimer and the first atomic bomb.
• *“WHAT I CANNOT BUILD, I CANNOT UNDERSTAND.” – attributed to Richard Feynman (physicist, philosopher, badass) as the last words on his blackboard at the time of his death as described in The Universe in a Nutshell by Stephen Hawking (physicist, philosopher, badass).

*Most other sources list this quote as “What I cannot create, I cannot understand.”

Full code for each 1000+ base pair watermark can be found in the related article in Science (figure S.1)

These watermarks do much more than function as the first brainteaser ever inscribed in an organism’s genetic code. As Venter described in the video, the watermarks serve the practical application of proving that the DNA coded in M. mycoides JCVIsyn1.0 is the artificial genome that JCVI programmed (and that is mostly adopted from the natural M. mycoides bacteria). It also serves as an indication of intellectual property rights, so we may see such watermarks appearing in many new synthetic organisms in the future. Finally, being able to include these watermarks is proof of the incredible feats capable when you program an organism’s DNA base pair by base pair.

Just think of the precision required for this work. Each base pair has to be placed correctly to form the watermark. The watermark itself has to be ‘neutered’ sandwiched by leading/trailing DNA sequences to make sure that the proteins encoded by the watermarks aren’t built by the cell’s mechanisms.

That precision has been put to other uses besides just writing messages. M. mycoides (the natural organism) is a mild pathogen found in goats. As Venter describes in the video (10:16), in the process of creating M. mycoides JCVIsyn1.0, the JCVI team deleted 14 of the genes it thinks are responsible for its toxicity in goats. They also insured that it has a dependence on a certain antibiotic and a need for a rich medium in the lab. These precautionary measures are used to insure that the synthetic bacteria is not only benign but also unable to escape, and such techniques are made possible through the same base pair precision used to code the watermarks. In the future the same procedure could be used to create ‘suicides genes’ and complex chemical dependency in synthetic organisms to keep them safe and controllable.

I think its hard to describe the powerful positive potential that is provided by JCVI’s DNA programming approach to synthetic biology. Building an organism base pair by base pair is just extraordinary. It will undoubtedly take years before a profitable and beneficial organism can be created for widespread use, but I don’t think it’s an exaggeration to say that this technology has the capability to profoundly change the world for the better in the near future. Already Venter is discussing how the techniques used to assemble the M. mycoides JCVIsyn1.0 DNA could be adapted to help create new vaccines rapidly and cheaply. We live in exciting times – the keys to life are in the hands of those who dare to use them.

[image credits: Gibson et al, Science 2010; JCVI]
[video credit: Science]
[source: Gibson et al, Science 2010, JCVI, Telegraph.co.uk]

Venter took synthetic biology to the next level: programming life.

Craig Venter wants to program life the way we program computers, and today he announced a momentous win: the first synthetic self-replicating bacterium. The J. Craig Venter Institute (JCVI) used the four types of chemicals that make up DNA, and complex assembly methods utilizing yeast cells, to ’program’ the 1.08 million base pairs that make up the genome for the bacteria cell. As described in the journal Science, the result was a synthetic copy of the Mycoplasma mycoides, dubbed M. mycoides JCVI-syn1.0, that can grow and divide like normal. The little “1.0″ highlights the vast potential of Venter’s project, as JCVI will be able to update and improve their synthetic organism base pair by base pair, gene by gene. Computers can now program sustainable synthetic life – welcome to the future.

JCVI, funded through Synthetic Genomic Inc, has been working on the concept of programming life for more than a decade. In 2003 they had programmed the first synthetic virus. In 2008 they created a synthetic bacteria genome but were unable to get it to thrive inside a cell. In Venter’s most recent presentation at TED, he described these efforts and said it was possible that 2010 would see the arrival of the first fully synthesized organism. Clearly he has delivered on that prediction with flying colors. The M. mycoides JCVI-syn1.0 represents a whole new level of synthetic biology. Science interviewed Venter about the endeavor via Skype:

The main methodology for synthetic biologists up to this point has been ‘cut and paste’. The DNA of one organism has been carefully selected and transplanted into another. In this way, scientists have been able to give the properties of one organism to another. This ‘gene-splicing’ or ‘bio-hacking’ is far from crude, and represents a growing and important field of study. MIT has an expanding databank of DNA, its Registy of Standard Biological Parts, that can be used to transform organisms (almost always bacteria) for synthetic biology projects. This methodology is at the heart of iGEM, OpenWetWare, and virtually every single other synthetic bio endeavor we’ve discussed at Singularity Hub.

This is the first fully synthetic biological organism: M. mycoides JCVI syn1.0

Venter just made that entire field of study look like finger painting next to a Picasso. JCVI’s approach to synthetic biology isn’t hacking, it’s programming from the ground up. Yes, this first bacterium was just a copy of a natural organism. But that copy was assembled base pair by base pair. In the future, instead of pain-stakingly slicing in genes from other bacteria, Venter can just change a few parameters in his computer software. When fully developed this technology will let you ‘code’ a new organism. Can you imagine the power of that kind of control? Forget finger painting and Picasso, this is the difference between playing Frankenstein and playing God.

Here you see the M. mycoides JCVI syn1.0 dividing. They're alive!

For those who missed Venter’s TED talk on the subject, let me describe briefly what this amazing process entails. The underlying concept is that the software of life (DNA) will build its own hardware (the cell). Using the four basic chemicals of DNA (the G,A,C,T) small snippets of genetic code are implanted into yeast cells. The yeast cells act as little factories, assembling these snippets into overlapping segments of DNA. When the newly programmed bacteria genome is assembled, it can be transplanted into a host bacterium where it takes over, rewriting the cell to create the new synthetic organism. Thus, while this is called a synthetic form of life, many natural forms of life are necessary to assemble it and provide its cytoplasm body. Keep in mind though that when the M. mycoides JCVI syn1.0 forms a colony, not a single bacterium will contain the proteins of the assembling yeast or host bacterium. The programmed DNA is king.

Despite JCVI’s amazing innovations with their new approach to synthetic biology, it’s likely that ‘bio-hacking’ will remain dominant in the near term. There are many more teams working with that technique, and years of experience with getting it to work. Even after the JCVI approach picks up speed, it is likely to copy many of its ideas from the greatest DNA programmer humans have ever seen: nature. In other words, most of the first changes to the 1.0 will probably be adoptions of known DNA segments from other natural organisms, so this will not seem so different from the bio-hacking approach. Eventually however, programming DNA is going to lead to an explosion of new organisms. Rather than slicing in a few genes at a time, JCVI and others will be able to ‘write’ genetic code. With enough computing power they would also be able to simulate these changes before ‘booting’ them up into real cells, but I’m not sure which approach (simulate or guess and check) will end up being more cost effective. Either way, we’ll be building new life from the ground up, custom building organisms for our needs.

Biofuels, vaccines, antibiotics, synthetic insulin, advanced solar cells…there’s an almost limitless amount of possible ‘first applications’ for this new technology. JCVI is already working with Exxon to create algae fuels though maybe they’lll take a stab at all of these ideas. It could take some time. As always with biotechnology, and with synthetic biology in particular, there are many safety and administrative hurdles to clear before lab work can be converted into marketable products. Will these synthetic species cause ecological damage if released out of the lab? Can we build fail-safe DNA (a genetic kill-switch) into these organisms to prevent their accidental or intentional misuse? Will customers trust a non-natural organism for biofuels/vaccines/whatever? Each of these questions will need to be addressed before we can reap the benefits of Venter’s work. One day soon, though, humanity will take its first cautious steps through the door of fully synthetic biology. When that happens we will see amazing and powerful changes. This could be the defining technology of the 21st century. May 20th, 2010. Remember the date.

[image credits: J. Craig Venter Institute]
[video credit: Science]
[source: JCVI, JCVI press release, Science]

In its first human practices draft-for-comment report, The BioFab: International Open Facility Advancing Biotechnology (BIOFAB) asked the core question of “what is a part?” in biology. The report explores the complexity, boundaries and evolution of biological engineering, and seeks to determine what standardization might mean for the industry.

One of BioFab’s projects—and they all seem quite ambitious—aims to build thousands of biological parts needed to control genetic expression in a select number of organisms. This collection—known as “C. dog.”—will make it possible to manipulate DNA/RNA/Protein synthesis in E. coli (a bacterium) and S. cerevisiae (a budding yeast). The product, to be used to aid researchers, will be released under the terms of a legal framework that enables the free exchange and use of standard biological parts.

Founded at the end of 2009 by bioengineering assistant professor Drew Endy and UC Berkeley’s Adam Arkin, The professionally staffed public-benefit facility represents “the first significant focused investment in the development of open technology platforms underlying and supporting the next generation of biotechnology” (BioFab.org). And with generous funding from the NSF and other prominent organizations, the operation will eventually be able to shell out tens of thousands of standard biological parts each year. While such a program reeks of ethical concerns, head of BioFab’s human practices Gaymon Bennett promises that ethical issues, including safety and security, will be addressed by creating resources that will help researchers make tough decisions. The effort will also create a new legal framework in support of its burgeoning technologies.

BioFab Directors Drew Endy (left) and Adam Arkin

Synthesizing biological parts from genes may have far-reaching ethical implications, but we can’t say it’s altogether a new idea. Designer babies have long been a part of public debate, and recent advancements like MIT’s registry of standard biological parts have paved the way for initiatives like BioFab. But there’s a big difference between making biological parts and figuring out how those parts will work together.

Creating functioning interchangeable biological parts is at the heart of BioFab’s mission. Taking modern synthetic biology’s mantra that a system is an integrated set of components one step further, BioFab will attempt to define, in context, what a component is, building on the assumption that standardized ‘parts’ don’t yet exist, and that such parts are made, not discovered.

It was clear from early on in biology’s synthetic saga that DNA’s unpredictable methods of assembly would make standardization a challenge, but several years into the new millennium a proposal was made as to how restriction enzymes could isolate DNA “BioBricks” that could effectively “mix and match” with one another using complimentary strands of overhanging base pairs. While this provided a solution to putting engineered DNA components together, it couldn’t solve how to get them to work together in predictable ways. It turns out that sans context, standardized biological parts are little more than words of an indecipherable language.

Quantifying and categorizing genetic structures—both upon which genome sequencing is based—are not in themselves new goals. The present conundrum lies not in the ability to break things down into workable units, but rather in how to reverse the process and create anew using those units. Such is the driving force behind bioengineering, and now BioFab.

[Image credit: BIOFAB, Margot Hartford]
[Source: BIOFAB, Stanford School of Medicine]

Want to tinker with DNA? Andrew Hessel is the guy who can explain how and why.

Have you ever wished life was more like a video game? Well, Andrew Hessel is here to tell you that your biology is already more like a computer than you know. At his recent talk at Singularity University the genetic engineering guru explained how biology was set to become the next information technology. Hessel is a veteran of the biotech industry, an advocate for open source technology, and one of the founders of the biology wiki, OpenWetWare. His presentation at Singularity University starts from scratch, describing the basics of synthetic bio and explaining how we could one day have “push button biology” – you design an organism, push a button, and out it comes. Check out the video presentation of “Hacking Genomes and Synthetic Biology” in full after the break.

Hessel is a big proponent of open source technology, which you can see in his founding of OpenWetWare, his support of DIYbio, and his ongoing interest and support of iGEM and MIT’s Registry of Standard Biological Parts. The man wants you to be interested and open to the possibilities that hacking DNA will provide. Synthetic biology, the engineering of life on the genetic level, could be the definitive technology of the 21st century. Educational genetic engineering (like iGEM) is beginning to filter into the high school level and Hessel believes that a time is coming soon when everyone could have access to the power and creative freedom of synthetic biology. When? Everyone has a different idea about the timing of the coming paradigm shift, but Hessel targets genetic sequencing as a key ingredient. When you can sequence 10 million base pairs in an hour for $100, he thinks that the genetic revolution will begin. That’s the point when it will become cheap enough for almost anyone to start programming with DNA.

Don’t have time for an hour long video? Check out the highlight reel below.

3:00 – Summary of synthetic biology as information technology.
9:19 – The History of Cells (as IT)
15:30 – The hockey-stick growth of known genetic information (GEN BANK)
17:00 – The number of species may experience its own hockey-stick growth curve.
19:40 – Writing genetic code
21:15 – The importance of DNA printers.
22:20 – DNA programming as a language.
24:00 – iGEM
25:00 – Registry of Standard Biological Parts.
26:00 – Synthetic biology enters high school, and do-it-yourself.
27:35 – Human genome synthesis is coming!
30:00 – End of talk, beginning of questions
30:10 Question#1 – Isn’t synthetic biology scary? What are the dangers of biological attacks?
31:45 – Q#2 – Are there any defenses against bio-terrorism?
33:30 – Q#3 – Peter Diamandis asks if future robots will be mechanical or biological.
37:00 – Q#4 – What are the ethics of using a living thing as a machine?
39:20 – Q#5 – Will the divide between humans and animals grow wider as we program life?
42:12 – Q#6 – Are there competitions in code standards (as there are with IT)?
43:37 – Q#7 – Would Darwin like synthetic biology?
44:00 – Q#8 – What will the biological lab of the future look like?
45:00 – Q#9 – Is synthetic biology going to be patented?
45:40 – Q#10 – How do you write code when it could mutate?
47:00 – Q#11 – Are we going to bring back dinosaurs?
48:15 – Q#12 – What impact will this have on forensic uses of DNA?
51:00 – Q#13 – How will security concerns affect growth of industry?
54:00 – Q#14 – Is there any limit to what synthetic biology can make?
55:30 – Q#15 – What’s the risk analysis with DNA printing?

Stay tuned to the Hub for more news about Singularity University and videos of their unique presentations. And check out SU’s twitter feed to keep up to date on everything going on in the program.

*Disclosure: Keith Kleiner (owner of Singularity Hub) is an associate founder at Singularity University.

[photo credit: Wired]
[video credit: Singularity University]

In the traditional model of scientific progress, researchers share information through two channels: published research and discussions at conferences. Six to twelve months could pass before one scientist learns about the discoveries made by another. OpenWetWare is a precursor to Science 2.0, a new paradigm wherein research learns some of the lessons of open source computer programming. By sharing information quickly online, scientists could reduce the duplication of work, create a quicker dialogue between teams, and develop dynamic and productive collaborations. In other words, the democratic dissemination of information would increase the efficiency of the scientific community, accelerating the rate at which the world benefits from their discoveries.

OpenWetWare evolved from a wiki called the Endipedia that was developed by two groups at MIT. As such, most of the steering committee for the site is based in the Boston area. DIYbio founder and friend of Singularity Hub, Mac Cowell, is one of the members of the committee (though I don’t know how active he is). Still, if the leadership of OWW is heavy with Cambridge citizens, its base of users is much more global. There are dozens of groups, and more than 100 labs that contribute to the site, including scientists from Imperial College (UK), University of Sao Paulo (Brazil), and Peking University (China). The diversity of its members reflects the diversity of the synthetic biology competition iGEM.

Which is fitting because a good deal of the OWW content is geared towards iGEM competitors. Synthetic biology requires a host of lab skills that often have to be developed quickly. There are a myriad number of lab protocols required even for the most basic of genetic engineering tasks. OWW provides descriptions of these protocols, as well as allowing users to describe their experience with them.

User editing in OWW isn’t as open as with Wikipedia. While ‘anyone’ can edit Wikipedia, you have to be a registered user to edit OWW. This restriction is a necessity. For although 7000 scientists is an awesome amount of intellectual power, it is no match for the teeming millions of vandals that troll the internet. So, while you or I could benefit from reading OWW, we can’t put in our two cents without first letting them know who we are. This has meant, according to OWW, that there have been no known instances of vandalism on the wiki. None. Zero. That’s amazing.

If you’re a biologist or synthetic biologist, or other professional, you may be asking yourself if you should get involved in OpenWetWare. The answer is yes, and OWW has an entire page dedicated to convincing you of that. In short, the website believes that shared information is better information. It is more robust, able to survive the loss of a labmate or a small typo much better than secret information. Wikis benefit those who share as much as they benefit those who receive.

Scientists often lose track of that “sharing is caring” vibe because the reward system in the scientific community is publication-centric. You don’t see Nobel Prizes handed out to scientists who haven’t published in a major journal. Large grants – all funding, really – comes from proving the validity of your work by having it appear in esteemed publications. That’s the on-the-ground truth of the situation. In order for OWW to become a viable means by which scientists feel inclined to share their most up to date and precious data, a new rewards system will have to be introduced. That system could be as simple as members of the scientific community recognizing and acknowledging the work shared on OWW. Every time a scientist joins OWW, or allows their lab to share information on it, or edits a page, they legitimize it as a respectable hub for the exchange of scientific thought. If enough biologists do so, ‘publishing’ on OWW will carry the prestige necessary to launch the community into Science 2.0.

Of course, there are ways that non-scientists can use and contribute to OWW as well. First, DIY biologists can read up on the protocols, materials, etc they need to perform their projects. Newcomers to synthetic biology are valued too. OWW needs the feedback of people who are autoclaving for the first time, or who have never isolated DNA before so that the wiki becomes a useful tool for those entering into the field. The more powerful a web resource OWW can create, the quicker prospective students will be able to become fully fledged biologists. About half a dozen college level courses already use OWW to share their curricula and help their students.

If we want to benefit from exponential returns on technology, we need a method of sharing ideas that is fast, reliable, and dynamic. I think a rigorous science wiki is that method. OpenWetWare is a great biological resource -looking at their site stats you see their wonderful increase in cumulative data over time. It’s inspiring and I would like to see parallel websites develop in other fields. Robotics and computer science already have several. Currently, different research teams use OWW differently, and that diversity of utility is part of what makes the wiki so appealing. In the future, I can only see benefits arising as more scientists divest themselves of the current scientific rewards system and favor the evolving wiki-model of collective knowledge. There will be less ownership of ideas and experimental results, but that loss will be balanced by a growth in the number and quality of those ideas and results. Less individual prestige but more shared understanding and benefit. Isn’t that why we started using science in the first place?

Synthetic biology has been called the science of the 21st century. Rewriting the genetic information of micro organisms can allow scientists to create new genetic machines that can perform extraordinary tasks. You remember MIT’s Registry of Standard Biological Parts we discussed? iGEM teams are given access to that database in order to come up with useful, interesting, or just plain cool genetic machines for the competition. MIT is allowing these undergraduates access to some of the most advanced synthetic biology tools of today in the hopes of developing students into the best genetic engineers of tomorrow. That’s exciting stuff.

For those completely new to the iGEM competition, undergraduate teams are formed in universities all over the world. They receive standard biological parts in the beginning of the summer and present their results during the jamboree in the fall. Not every institution can sponsor an iGEM team. They require funding, access to advanced equipment, and most importantly: synthetic biology expertise. Each team has faculty advisors that help students understand biotechnology, and guide them in its use to accomplish the task they desire.

While an iGEM team’s requirements are severe, the number of institutions sponsoring them has increased dramatically. The first iGEM competition in 2004 had just 5 teams attending. Last year saw 84 teams. This year there will be more than 110. The interest and capabilities of synthetic biology undergraduate programs all over the world are increasing at a wonderful rate.

iGEM 2008 had 84 teams. This year will have 110+. Like the bacteria they engineer, iGEM teams are growing at a phenomenal rate.

It really is wonderful news to see so many groups interested in iGEM. These undergraduates aren’t just creating neat science projects that will help them get genetic engineering jobs in the future, they are making differences now. Last year’s grand prize winner, Slovenia, engineered a vaccine to Heliobacter pylori, a bacteria that infects up to half the world’s population, causing gastritis and ulcers. H. pylori is often drug resistant, meaning that Slovenia’s vaccine is a new and needed solution to infection.

While it is the premier undergraduate competition of its kind, iGEM could be more. Our old pal Mac Cowell from DIYbio was trying to get a do-it-yourself team into iGEM 2009 but was (kindly) told that iGEM wasn’t ready for DIY biology groups yet, mainly due to issues surrounding safety and funding. We still might see a DIYgem team in 2010.

For now, I’m just anxious to see what amazing biological machines will be debuted on Halloween this year. Stay tuned to Singularity Hub for coverage of the competition and discussion of the results as they are announced. Trust me, folks, cool things are coming out of synthetic biology, and iGEM never fails to impress.

MIT is helping synthetic biologists by providing the Registry of Standard biological Parts.

While there are some costs associated with getting genes from the Registry, it’s not really a store. The registered segments of DNA are stored and shipped on a looser “get some, give some” exchange. Those users who request and utilize these biological parts are expected to share some of their results and innovations with everyone else. Sort of the biological equivalent of the take-a-penny-leave-a-penny tray at the corner store.

Before you start sending your genetic requests to MIT, I should point out that the Registry is for established scientists only. Do-it-yourself biologists need not apply. Most of those who receive parts are from academic labs, and/or forming a team to participate in iGEM, MIT’s annual genetic engineering competition. Still, the wide range of users gives this registry a scope that promises to catapult synthetic biology into its next phase of evolution.

She’s a brick house…
When you’re asking for a few parts, the Registry is your place to sift through and plan. But how can you be sure to splice the DNA into your creation in the right way? How can you make sure that each part you want is complete? Thankfully, the registry conforms to the Biobricks ™ standard. Biobrick ™ is a way of standardizing interchangeable genetic parts, allowing each developer to work separately but still design DNA that can work with everyone else’s creations. It was developed by a not-for-profit company composed of researchers from MIT, Harvard, and UCSF. Just to be clear, Biobricks™ and the Registry aren’t the same thing: one’s a standard and the other is storage. Together, however, the two are helping create a common vocabulary of genetic innovations.

We’ve seen this same approach in the field of robotics with Willow Garage. In fact, it’s pretty much the open-source template that software gurus have been creating for some time. In biology, the result is less open-source and more open-community. Even while working in different labs with different goals, by participating in the registry and using a standardized way of formulating synthetic genes scientists are helping raise the capabilities of the entire group. Along with a wiki for the parts, and some basic tutorials, this group dynamic allows relative new-comers to the field to get up to speed quickly. The more researchers who operate at this high level, the more innovations are bound to be produced. In essence, the Registry is a positive feedback loop, allowing each development to lead to other developments in an increasing spiral of genetic know-how.

Besides the social benefits, however, the Registry also provides some rock-solid advantages when using their standards. Most parts come with a gene (ccdB) that helps filter out specimens that haven’t received the gene. When you are modifying the DNA of an organism, it’s not always easy to tell which (if any) organisms have added the new genes correctly. By utilizing ccdB, scientists can kill off those cells which don’t have the modified genetics and keep the ones that do. There are many other “genetic tools” included in the database that help you manipulate DNA by moving, promoting, connecting, etc. In this way, the Registry isn’t just a gene depot, it’s also a genetic appliance warehouse.

There is still a lot of room for improvement. Most of the sequences described in the Registry still haven’t been built yet. Those genes that are complete may be categorized poorly. Even with intimate knowledge of synthetic biology, wading through the Registry can take considerable time and effort. Hopefully MIT will organize the system better. Establishing guidelines and rewards that will encourage development is likely in the future. Already, the Biobricks ™ foundation is working on a licensing scheme for new parts.

The Future is for Designers

We can’t talk about synthetic biology without mentioning some of its dangers. As tirelessly as researchers at MIT, and other institutes, pursue better living through genetics, other more nefarious work is undoubtedly being pursued elsewhere. Genetically modified warfare, or terrorism, is an unfortunate consequence of a better understanding of biology. Even discounting intentional biological attacks, we still have accidents to worry about. While developing a bacterium that could consume industrial waste, scientists could create one that devoured living tissue. The doomsday scenarios are endless but also avoidable. Part of the reason to standardize biological parts is to better control how those parts are integrated into living things. Better understanding, and standardized techniques will cut down on accidents. And the best defense against biological terrorism is a comprehensive set of genetic material that can be adapted to combat new threats. Far from increasing our risks, the Registry is a tool for avoiding them.

As the Registry and the Biobricks™ standard develop though, scientists will spend less time building genetic parts and more time experimenting with genetically modified creations. In the short term that of course means more cool micro-organisms that can perform miraculous tasks. Just looking at last year’s iGEM competition we see vaccines, teeth-cleaning yogurt, bio-sensors, bacterial computers, and many more crazy and wonderful creations. In the long-term, the rapid testing of genetic manipulations will eventually lead to an understanding of how every part of an organism is built. In the end, scientists won’t be using the Registry parts to modify cells, they’ll design an organism from the ground up.

That is when the real change will begin. Evolution has provided each organism you want to modify with a huge set of genes, expressed or otherwise, that have allowed it to succeed. Most of these genes don’t have anything to do with what humans want: a cell that performs a certain task. By starting from the ground up, scientists could create organisms that just do what they are told, nothing else.

Natural organisms also come from ecosystems complete with predators, a preferred food source, and environmental requirements. A designed organism could be free of all of those. No more worrying if the bacteria creating your bio-fuel will be wiped out by a virus. Did you build something that could harm people? Well, design it to die at 98 degrees Fahrenheit and maybe we won’t have to be concerned. Of course, genetic design isn’t a panacea. There will undoubtedly be new concerns and new limitations. The Registry of Standard Biological Parts, however, will help accelerate genetic engineering to overcome these concerns and limitations.

Obviously restricting access to these potentially powerful and dangerous genes is a good thing, and it makes a lot of sense for the Registry to be available only to scientists. However, as genetic engineering becomes more accessible to more people, I hope that the Registry follows suit. Already we’ve seen that the DIYbio communityis a growing and responsible set of amateur enthusiasts. I would be excited to see what such at-home researchers could produce if given access to a wider set of genetic information. For now, most DIY types wouldn’t even be able to utilize parts from the Registry (they don’t have the equipment or expertise), but that may change as wet-labs themselves become standardized and easier to understand.

What will we create with the building blocks of life?

Whether in the hands of traditional scientists or in a broader context of genetic enthusiasts, the standardization of genetic parts is a remarkable undertaking. MIT could possibly becomes the global hub for genetic engineering for no other reason than Biobricks™ and the Registry. As with so many other developments in technology, the way in which new creations are made has become as important as the creations themselves. As a child, I built spaceships, secret bases, and x-ray glasses out of Legos. Using the genetic equivalent, I have no doubt that synthetic biologists will construct even cooler creations.