Explore Topics:
AIBiotechnologyRoboticsComputingFutureScienceSpaceEnergyTech
Biotechnology

Secret Messages Coded Into DNA Of Venter Synthetic Bacteria

Aaron Saenz
May 24, 2010
Secret Messages Coded Into DNA Of Venter Synthetic Bacteria

Share

Researchers at the J Craig Venter Institute recently unveiled their first self-replicating synthetic bacteria (M. mycoides JCVI-syn1.0) whose DNA was 'programmed' base pair by base pair. To verify that they had synthesized a new organism and not assembled the DNA from another natural bacteria, scientists encoded a series of 'watermarks' into the genes of M. mycoides JCVI-syn1.0. There are four of these hidden messages: an explanation of the coding system used, a URL address for those who crack the code to go visit, a list of 46 authors and contributors, and a series of famous quotes. The presence of these watermarks verifies that M. mycoides JCVI-syn1.0 truly is synthetic and demonstrates the precision and power of JCVI's new techniques in synthetic biology.

Craig Venter mentioned these watermarks in his interview with the journal Science, which published the most recent work with M. mycoides JCVI-syn1.0. Watch from 7:20 to 9:20 to hear him describe the idea:

This isn't the first time that JCVI has been marking its territory. Back in 2008 when they were still working on getting a bacteria genome assembled they used the four 'letters' of DNA (G,A,T,C) to scribble a few words into its genetic code. These messages used codons, groups of three letters which code for amino acids, to stand for 20 letters of the alphabet. As such, some substitutions (like 'v' for 'u') were necessary. The results were relatively simple but still pretty cool:

CRAIGVENTER coded as: TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA

VENTERINSTITVTE coded as: TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTAACTAGCTAA

HAMSMITH coded as: TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA

CINDIANDCLYDE coded as: TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGCTAATGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATG

GLASSANDCLYDE coded as: TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA

For the creation of M. mycoides JCVIsyn1.0, the J. Craig Venter Institute decided to produce much larger and more elaborate watermarks. Each of the four is more than one thousand base pairs long. Also, instead of coding for just 20 letters, the new system includes all letters and forms of punctuation for the English language. This makes it very unlikely that JCVI is using the codon system from 2008. Want to actually code the messages? Thankfully you won't need to get a copy of M. mycoides JCVIsyn1.0 and sequence its DNA. In their publication in Science, JCVI included a figure (S.1) which lists the base pairs for each watermark. They have a diagram of the bacteria's DNA (here as PDF) which may come in handy in case position in the genome has some bearing on the way the information is encoded. To make things even clearer, JCVI also released the quotes used in the fourth watermark. Here they are:

Be Part of the Future

Sign up to receive top stories about groundbreaking technologies and visionary thinkers from SingularityHub.

100% Free. No Spam. Unsubscribe any time.
  • "TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE." - from James Joyce's A Portrait of the Artist as a Young Man.
  • "SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE.”- a quote from the book, American Prometheus which discusses J. Robert Oppenheimer and the first atomic bomb.
  • *"WHAT I CANNOT BUILD, I CANNOT UNDERSTAND." - attributed to Richard Feynman (physicist, philosopher, badass) as the last words on his blackboard at the time of his death as described in The Universe in a Nutshell by Stephen Hawking (physicist, philosopher, badass).

*Most other sources list this quote as "What I cannot create, I cannot understand."

These watermarks do much more than function as the first brainteaser ever inscribed in an organism's genetic code. As Venter described in the video, the watermarks serve the practical application of proving that the DNA coded in M. mycoides JCVIsyn1.0 is the artificial genome that JCVI programmed (and that is mostly adopted from the natural M. mycoides bacteria). It also serves as an indication of intellectual property rights, so we may see such watermarks appearing in many new synthetic organisms in the future. Finally, being able to include these watermarks is proof of the incredible feats capable when you program an organism's DNA base pair by base pair.

Just think of the precision required for this work. Each base pair has to be placed correctly to form the watermark. The watermark itself has to be 'neutered' sandwiched by leading/trailing DNA sequences to make sure that the proteins encoded by the watermarks aren't built by the cell's mechanisms.

That precision has been put to other uses besides just writing messages. M. mycoides (the natural organism) is a mild pathogen found in goats. As Venter describes in the video (10:16), in the process of creating M. mycoides JCVIsyn1.0, the JCVI team deleted 14 of the genes it thinks are responsible for its toxicity in goats. They also insured that it has a dependence on a certain antibiotic and a need for a rich medium in the lab. These precautionary measures are used to insure that the synthetic bacteria is not only benign but also unable to escape, and such techniques are made possible through the same base pair precision used to code the watermarks. In the future the same procedure could be used to create 'suicides genes' and complex chemical dependency in synthetic organisms to keep them safe and controllable.

I think its hard to describe the powerful positive potential that is provided by JCVI's DNA programming approach to synthetic biology. Building an organism base pair by base pair is just extraordinary. It will undoubtedly take years before a profitable and beneficial organism can be created for widespread use, but I don't think it's an exaggeration to say that this technology has the capability to profoundly change the world for the better in the near future. Already Venter is discussing how the techniques used to assemble the M. mycoides JCVIsyn1.0 DNA could be adapted to help create new vaccines rapidly and cheaply. We live in exciting times - the keys to life are in the hands of those who dare to use them.

We are a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for us to earn fees by linking to Amazon.com and affiliated sites.

Related Articles

MitoCatch tethers healthy mitochondria to cells in need of an energy reboot

Scientists Revive Failing Cells With Mitochondria Transplants

Shelly Fan
Colorized scanning electron micrograph of HIV-1 virus particles (yellow) both budding and attached to the surface of Hut-78/human lymphocyte cells (purple). Image captured at the NIAID Integrated Research Facility in Fort Detrick, Maryland.

Norwegian Man Cured of HIV by His Brother’s Stem Cells

Shelly Fan
A human B cell

One Shot Just Crushed Three Deadly Autoimmune Diseases

Shelly Fan
MitoCatch tethers healthy mitochondria to cells in need of an energy reboot
Biotechnology

Scientists Revive Failing Cells With Mitochondria Transplants

Shelly Fan
Colorized scanning electron micrograph of HIV-1 virus particles (yellow) both budding and attached to the surface of Hut-78/human lymphocyte cells (purple). Image captured at the NIAID Integrated Research Facility in Fort Detrick, Maryland.
Biotechnology

Norwegian Man Cured of HIV by His Brother’s Stem Cells

Shelly Fan
A human B cell
Biotechnology

One Shot Just Crushed Three Deadly Autoimmune Diseases

Shelly Fan

What we’re reading

Be Part of the Future

Sign up to receive top stories about groundbreaking technologies and visionary thinkers from SingularityHub.

100% Free. No Spam. Unsubscribe any time.

SingularityHub chronicles the technological frontier with coverage of the breakthroughs, players, and issues shaping the future.

Follow Us On Social

About

  • About Hub
  • About Singularity

Get in Touch

  • Contact Us
  • Pitch Us
  • Brand Partnerships

Legal

  • Privacy Policy
  • Terms of Use
© 2026 Singularity